Rh4CG396100
NAC Family

NAC transcription factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
64602652 .. 64602990
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG396100.1

Sequence Viewer

Length: 339 bp
ATGACCAATCACAGCCCCTGTGACGCTACAAAACGACGAATTCCCCCAACCATAAAAGGAGGAGCCCTCTCCGTTCAAACATTTCAAACACTTCATTTCTCTAAAACCCTAACTATCTGTTTAGCTTCTAGCAGTAGGTTTGATCCAGCTTTTTTGCAGACCACAACAATGGAGGCCAATAATGGCTCTGGACTTCCTCCTGGTTTTAGGTTCCACCCAACTGATGAGGAACTCATTGTGTATTACCTCAAAAACCAAGCCATTTCAAAGCCGTGCCCTGTTTCCATCATCCCAGAAGTCGATATCTACAAGTTTGATCCTTGGCAATTGCCTGGTTAG

Protein Analysis

112

Amino Acids

12.44

Weight (kDa)

7.74

Isoelectric Point (pI)

41.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM PF02365 66 - 111 5e-17 No apical meristem (NAM) protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0032695)

Species Orthologous Gene IDs
rosa_samantha Rh4AG369600 Rh4CG396100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 137, 311
AcsI RAATTY 1 cut(s) 39
AgsI TTSAA 3 cut(s) 77, 86, 267
AjnI CCWGG 2 cut(s) 199, 331
AluBI AGCT 2 cut(s) 125, 149
AluI AGCT 2 cut(s) 125, 149
AlwI GGATC 2 cut(s) 137, 311
AlwNI CAGNNNCTG 1 cut(s) 18
AoxI GGCC 1 cut(s) 174
ApoI RAATTY 1 cut(s) 39
BaeGI GKGCMC 1 cut(s) 278
BanII GRGCYC 1 cut(s) 67
BccI CCATC 1 cut(s) 293
BceAI ACGGC 1 cut(s) 256
BciT130I CCWGG 2 cut(s) 201, 333
BfaI CTAG 1 cut(s) 129
Bme1390I CCNGG 2 cut(s) 201, 333
BmiI GGNNCC 2 cut(s) 64, 212
BmrFI CCNGG 2 cut(s) 201, 333
BplI GAGNNNNNCTC 2 cut(s) 51, 83
BsaJI CCNNGG 1 cut(s) 320
BseBI CCWGG 2 cut(s) 201, 333
BseDI CCNNGG 1 cut(s) 320
BseGI GGATG 1 cut(s) 288
BseRI GAGGAG 1 cut(s) 75
BseSI GKGCMC 1 cut(s) 278
BshFI GGCC 1 cut(s) 176
BsnI GGCC 1 cut(s) 176
Bsp1286I GDGCHC 2 cut(s) 67, 278
Bsp143I GATC 2 cut(s) 142, 316
BspANI GGCC 1 cut(s) 176
BspLI GGNNCC 2 cut(s) 64, 212
BspPI GGATC 2 cut(s) 137, 311
BssECI CCNNGG 1 cut(s) 320
BssMI GATC 2 cut(s) 142, 316
BssT1I CCWWGG 1 cut(s) 320
Bst2UI CCWGG 2 cut(s) 201, 333
BstF5I GGATG 1 cut(s) 288
BstKTI GATC 2 cut(s) 145, 319
BstMBI GATC 2 cut(s) 142, 316
BstNI CCWGG 2 cut(s) 201, 333
BstSCI CCNGG 2 cut(s) 199, 331
BstSLI GKGCMC 1 cut(s) 278
BstXI CCANNNNNNTGG 1 cut(s) 169
BsuRI GGCC 1 cut(s) 176
BtsCI GGATG 1 cut(s) 288
CaiI CAGNNNCTG 1 cut(s) 18
CseI GACGC 1 cut(s) 32
CviJI RGCY 8 cut(s) 15, 65, 125, 149, 176, 186, 260, 271
CviKI_1 RGCY 8 cut(s) 15, 65, 125, 149, 176, 186, 260, 271
DpnI GATC 2 cut(s) 144, 318
DpnII GATC 2 cut(s) 142, 316
Eco130I CCWWGG 1 cut(s) 320
Eco24I GRGCYC 1 cut(s) 67
Eco32I GATATC 1 cut(s) 304
EcoRI GAATTC 1 cut(s) 39
EcoRII CCWGG 2 cut(s) 199, 331
EcoRV GATATC 1 cut(s) 304
EcoT14I CCWWGG 1 cut(s) 320
EcoT38I GRGCYC 1 cut(s) 67
ErhI CCWWGG 1 cut(s) 320
FaiI YATR 1 cut(s) 53
FokI GGATG 1 cut(s) 275
FriOI GRGCYC 1 cut(s) 67
FspBI CTAG 1 cut(s) 129
HaeIII GGCC 1 cut(s) 176
HgaI GACGC 1 cut(s) 32
Hpy188III TCNNGA 1 cut(s) 189
Hpy99I CGWCG 1 cut(s) 39
HpyCH4V TGCA 1 cut(s) 157
Kzo9I GATC 2 cut(s) 142, 316
LmnI GCTCC 1 cut(s) 62
LpnPI CCDG 8 cut(s) 31, 159, 174, 186, 213, 291, 306, 318
MaeI CTAG 1 cut(s) 129
MaeIII GTNAC 1 cut(s) 20
MalI GATC 2 cut(s) 144, 318
MboI GATC 2 cut(s) 142, 316
MfeI CAATTG 1 cut(s) 326
MhlI GDGCHC 2 cut(s) 67, 278
MluCI AATT 2 cut(s) 39, 326
MnlI CCTC 6 cut(s) 53, 77, 166, 207, 220, 257
MslI CAYNNNNRTG 1 cut(s) 167
MspR9I CCNGG 2 cut(s) 201, 333
MunI CAATTG 1 cut(s) 326
MvaI CCWGG 2 cut(s) 201, 333
NdeII GATC 2 cut(s) 142, 316
NlaIV GGNNCC 2 cut(s) 64, 212
NmuCI GTSAC 1 cut(s) 20
Psp6I CCWGG 2 cut(s) 199, 331
PspGI CCWGG 2 cut(s) 199, 331
PspN4I GGNNCC 2 cut(s) 64, 212
PstNI CAGNNNCTG 1 cut(s) 18
RseI CAYNNNNRTG 1 cut(s) 167
Sau3AI GATC 2 cut(s) 142, 316
ScrFI CCNGG 2 cut(s) 201, 333
SduI GDGCHC 2 cut(s) 67, 278
SetI ASST 5 cut(s) 127, 140, 151, 212, 249
SmiMI CAYNNNNRTG 1 cut(s) 167
Sse9I AATT 2 cut(s) 39, 326
SspMI CTAG 1 cut(s) 129
StyD4I CCNGG 2 cut(s) 199, 331
StyI CCWWGG 1 cut(s) 320
TaqI TCGA 1 cut(s) 300
TasI AATT 2 cut(s) 39, 326
TseFI GTSAC 1 cut(s) 20
Tsp45I GTSAC 1 cut(s) 20
TspDTI ATGAA 1 cut(s) 83
TspGWI ACGGA 1 cut(s) 61
XapI RAATTY 1 cut(s) 39
XspI CTAG 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.