Rh4DG172600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
34383532 .. 34384168
637 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG172600.1

Sequence Viewer

Length: 171 bp
ATGCAAGCCTCTATATCCCTACCAGTTCATGCATCATCTTCATCATCCCAGCCAACACGGCCATCTTCAGAGCCAGTAAGTGGAAACCAGTTCATGCATCCCACAACTGGGATAAAGATAACGACCAAGTCCCCTACAAAGAGGAAGAGAGTTCCGGCAAACAAGAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

5.99

Weight (kDa)

11.75

Isoelectric Point (pI)

86.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024978)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0412771
rosa_samantha Rh4BG175200 Rh4DG172600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 80
AcoI YGGCCR 1 cut(s) 59
AcuI CTGAAG 1 cut(s) 51
AfiI CCNNNNNNNGG 3 cut(s) 80, 107, 108
AoxI GGCC 1 cut(s) 59
BccI CCATC 1 cut(s) 70
BceAI ACGGC 1 cut(s) 74
BglI GCCNNNNNGGC 1 cut(s) 58
BmrI ACTGGG 1 cut(s) 117
BmsI GCATC 2 cut(s) 41, 106
BmuI ACTGGG 1 cut(s) 117
Bsc4I CCNNNNNNNGG 3 cut(s) 80, 107, 108
Bse1I ACTGG 4 cut(s) 23, 74, 88, 112
BseGI GGATG 2 cut(s) 44, 97
BseLI CCNNNNNNNGG 3 cut(s) 80, 107, 108
BseNI ACTGG 4 cut(s) 23, 74, 88, 112
BseYI CCCAGC 1 cut(s) 48
BshFI GGCC 1 cut(s) 61
BsiSI CCGG 1 cut(s) 155
BslFI GGGAC 1 cut(s) 115
BslI CCNNNNNNNGG 3 cut(s) 80, 107, 108
BsmFI GGGAC 1 cut(s) 115
BsnI GGCC 1 cut(s) 61
BspANI GGCC 1 cut(s) 61
BsrI ACTGG 4 cut(s) 23, 74, 88, 112
Bst6I CTCTTC 1 cut(s) 140
BstC8I GCNNGC 1 cut(s) 6
BstF5I GGATG 2 cut(s) 44, 97
BstMWI GCNNNNNNNGC 1 cut(s) 58
BsuRI GGCC 1 cut(s) 61
BtsCI GGATG 2 cut(s) 44, 97
Cac8I GCNNGC 1 cut(s) 6
CviAII CATG 2 cut(s) 29, 94
CviJI RGCY 4 cut(s) 8, 52, 61, 73
CviKI_1 RGCY 4 cut(s) 8, 52, 61, 73
EaeI YGGCCR 1 cut(s) 59
Eam1104I CTCTTC 1 cut(s) 140
EarI CTCTTC 1 cut(s) 140
Eco57I CTGAAG 1 cut(s) 51
EcoT22I ATGCAT 2 cut(s) 34, 99
FaeI CATG 2 cut(s) 32, 97
FaiI YATR 3 cut(s) 14, 30, 95
FaqI GGGAC 1 cut(s) 115
FatI CATG 2 cut(s) 28, 93
FokI GGATG 2 cut(s) 31, 84
GsaI CCCAGC 1 cut(s) 52
HaeIII GGCC 1 cut(s) 61
HapII CCGG 1 cut(s) 155
Hin1II CATG 2 cut(s) 32, 97
HpaII CCGG 1 cut(s) 155
Hpy188I TCNGA 1 cut(s) 70
HpyCH4V TGCA 3 cut(s) 4, 32, 97
HpyF10VI GCNNNNNNNGC 1 cut(s) 58
Hsp92II CATG 2 cut(s) 32, 97
LpnPI CCDG 5 cut(s) 36, 62, 87, 93, 101
LweI GCATC 2 cut(s) 41, 106
MboII GAAGA 3 cut(s) 30, 57, 157
MnlI CCTC 2 cut(s) 19, 135
Mph1103I ATGCAT 2 cut(s) 34, 99
MspI CCGG 1 cut(s) 155
MwoI GCNNNNNNNGC 1 cut(s) 58
NlaIII CATG 2 cut(s) 32, 97
NsiI ATGCAT 2 cut(s) 34, 99
PflFI GACNNNGTC 1 cut(s) 127
PflMI CCANNNNNTGG 1 cut(s) 80
PspFI CCCAGC 1 cut(s) 48
PsyI GACNNNGTC 1 cut(s) 127
SfaNI GCATC 2 cut(s) 41, 106
TspDTI ATGAA 3 cut(s) 17, 30, 82
Tth111I GACNNNGTC 1 cut(s) 127
Van91I CCANNNNNTGG 1 cut(s) 80
Zsp2I ATGCAT 2 cut(s) 34, 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.