Rh5AG185800

Protein of unknown function, DUF604

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0025544
Physical Location & Seq
Forward (+)
21256955 .. 21257410
456 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG185800.1

Sequence Viewer

Length: 219 bp
ATGGTTGGCTCCGTCAACACATTGAAGCACAGAACATCATACATTGAAGCATGGTGGCGGCCCAATGTCACTCGAGGATGCCTCTTTTTGGATCCTCCTACTGCAGCGTTTTTGCCTTGGCCTTCATCCTATCCTCCTTTTCCTGTCAATGAGGACATCACTAGATTAAAAGTGTACCCGAAAATTTTGAATACGGTCCAAGCACGCATACATTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF604

Protein Analysis

72

Amino Acids

8.36

Weight (kDa)

9.74

Isoelectric Point (pI)

39.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025544)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002839.1_g000002
rosa_samantha Rh5AG185800
rosa_wichuraiana Rw5G016860

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 58
AclWI GGATC 2 cut(s) 86, 99
AcsI RAATTY 1 cut(s) 183
AfaI GTAC 1 cut(s) 176
AfiI CCNNNNNNNGG 1 cut(s) 88
AgsI TTSAA 3 cut(s) 25, 47, 190
AlwI GGATC 2 cut(s) 86, 99
Ama87I CYCGRG 1 cut(s) 72
AoxI GGCC 2 cut(s) 59, 119
ApeKI GCWGC 1 cut(s) 104
ApoI RAATTY 1 cut(s) 183
AspS9I GGNCC 2 cut(s) 60, 196
AvaI CYCGRG 1 cut(s) 72
AvaII GGWCC 1 cut(s) 196
BamHI GGATCC 1 cut(s) 91
BbvI GCAGC 1 cut(s) 116
BfaI CTAG 1 cut(s) 162
BfmI CTRYAG 1 cut(s) 102
BisI GCNGC 2 cut(s) 59, 105
BlsI GCNGC 2 cut(s) 60, 106
Bme18I GGWCC 1 cut(s) 196
BmeT110I CYCGRG 1 cut(s) 72
BmgT120I GGNCC 2 cut(s) 60, 196
BmiI GGNNCC 2 cut(s) 10, 93
BmsI GCATC 1 cut(s) 68
BplI GAGNNNNNCTC 2 cut(s) 66, 98
BsaJI CCNNGG 1 cut(s) 116
Bsc4I CCNNNNNNNGG 1 cut(s) 88
BseDI CCNNGG 1 cut(s) 116
BseGI GGATG 2 cut(s) 83, 125
BseLI CCNNNNNNNGG 1 cut(s) 88
BseXI GCAGC 1 cut(s) 116
BshFI GGCC 2 cut(s) 61, 121
BsiHKCI CYCGRG 1 cut(s) 72
BslI CCNNNNNNNGG 1 cut(s) 88
BsnI GGCC 2 cut(s) 61, 121
BsoBI CYCGRG 1 cut(s) 72
Bsp143I GATC 1 cut(s) 91
BspACI CCGC 1 cut(s) 58
BspANI GGCC 2 cut(s) 61, 121
BspLI GGNNCC 2 cut(s) 10, 93
BspMAI CTGCAG 1 cut(s) 106
BspPI GGATC 2 cut(s) 86, 99
BssECI CCNNGG 1 cut(s) 116
BssMI GATC 1 cut(s) 91
BssT1I CCWWGG 1 cut(s) 116
Bst4CI ACNGT 1 cut(s) 196
BstC8I GCNNGC 1 cut(s) 205
BstF5I GGATG 2 cut(s) 83, 125
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstSFI CTRYAG 1 cut(s) 102
BstV1I GCAGC 1 cut(s) 116
BstX2I RGATCY 1 cut(s) 91
BstYI RGATCY 1 cut(s) 91
BsuRI GGCC 2 cut(s) 61, 121
BtsCI GGATG 2 cut(s) 83, 125
Cac8I GCNNGC 1 cut(s) 205
Cfr13I GGNCC 2 cut(s) 60, 196
Csp6I GTAC 1 cut(s) 175
CviAII CATG 1 cut(s) 51
CviJI RGCY 3 cut(s) 9, 61, 121
CviKI_1 RGCY 3 cut(s) 9, 61, 121
CviQI GTAC 1 cut(s) 175
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
Eco130I CCWWGG 1 cut(s) 116
Eco47I GGWCC 1 cut(s) 196
Eco88I CYCGRG 1 cut(s) 72
EcoT14I CCWWGG 1 cut(s) 116
ErhI CCWWGG 1 cut(s) 116
FaeI CATG 1 cut(s) 54
FaiI YATR 3 cut(s) 40, 52, 209
FatI CATG 1 cut(s) 50
Fnu4HI GCNGC 2 cut(s) 59, 105
FokI GGATG 2 cut(s) 90, 112
Fsp4HI GCNGC 2 cut(s) 59, 105
FspBI CTAG 1 cut(s) 162
GluI GCNGC 2 cut(s) 59, 105
HaeIII GGCC 2 cut(s) 61, 121
Hin1II CATG 1 cut(s) 54
HincII GTYRAC 1 cut(s) 16
HindII GTYRAC 1 cut(s) 16
Hpy166II GTNNAC 2 cut(s) 16, 175
Hpy8I GTNNAC 2 cut(s) 16, 175
HpyAV CCTTC 1 cut(s) 132
HpyCH4III ACNGT 1 cut(s) 196
HpyCH4V TGCA 1 cut(s) 104
Hsp92II CATG 1 cut(s) 54
Kzo9I GATC 1 cut(s) 91
LmnI GCTCC 1 cut(s) 14
LpnPI CCDG 1 cut(s) 156
Lsp1109I GCAGC 1 cut(s) 116
LweI GCATC 1 cut(s) 68
MaeI CTAG 1 cut(s) 162
MaeIII GTNAC 1 cut(s) 67
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MflI RGATCY 1 cut(s) 91
MluCI AATT 1 cut(s) 183
MnlI CCTC 5 cut(s) 68, 92, 105, 144, 145
MseI TTAA 2 cut(s) 167, 217
NdeII GATC 1 cut(s) 91
NlaIII CATG 1 cut(s) 54
NlaIV GGNNCC 2 cut(s) 10, 93
NmuCI GTSAC 1 cut(s) 67
PaeR7I CTCGAG 1 cut(s) 72
PkrI GCNGC 2 cut(s) 60, 106
PspN4I GGNNCC 2 cut(s) 10, 93
PspPI GGNCC 2 cut(s) 60, 196
PspXI VCTCGAGB 1 cut(s) 72
PstI CTGCAG 1 cut(s) 106
PsuI RGATCY 1 cut(s) 91
RsaI GTAC 1 cut(s) 176
RsaNI GTAC 1 cut(s) 175
SaqAI TTAA 2 cut(s) 167, 217
SatI GCNGC 2 cut(s) 59, 105
Sau3AI GATC 1 cut(s) 91
Sau96I GGNCC 2 cut(s) 60, 196
SfaNI GCATC 1 cut(s) 68
SfcI CTRYAG 1 cut(s) 102
Sfr274I CTCGAG 1 cut(s) 72
SgeI CNNG 8 cut(s) 63, 84, 86, 129, 155, 174, 190, 212
SinI GGWCC 1 cut(s) 196
SlaI CTCGAG 1 cut(s) 72
SmlI CTYRAG 1 cut(s) 72
SmoI CTYRAG 1 cut(s) 72
Sse9I AATT 1 cut(s) 183
SsiI CCGC 1 cut(s) 58
SspMI CTAG 1 cut(s) 162
StyI CCWWGG 1 cut(s) 116
TaaI ACNGT 1 cut(s) 196
TaqI TCGA 1 cut(s) 73
TasI AATT 1 cut(s) 183
TauI GCSGC 1 cut(s) 61
Tru1I TTAA 2 cut(s) 167, 217
Tru9I TTAA 2 cut(s) 167, 217
TseFI GTSAC 1 cut(s) 67
TseI GCWGC 1 cut(s) 104
Tsp45I GTSAC 1 cut(s) 67
TspDTI ATGAA 1 cut(s) 114
VpaK11BI GGWCC 1 cut(s) 196
XapI RAATTY 1 cut(s) 183
XhoI CTCGAG 1 cut(s) 72
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.