Rh5AG285500

RNA recognition motif

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
38657903 .. 38658175
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG285500.1

Sequence Viewer

Length: 156 bp
ATGGCCTCTGCCGACATCGAGTTTCGTTGCTTCGTCGGAGGGATCGCCTGCGCCACCGACAACGATGCACTCGAAAGGAGATCATCGAATCGAAGGTCTGTTAGTCGCAGAGATCAGATGGATCGGATCTGTTCTCTCATCTCTATTGAAGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

5.74

Weight (kDa)

5.21

Isoelectric Point (pI)

96.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024877)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0099481 RchiOBHm_Chr5g0042331
rosa_samantha Rh5AG285500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 50, 129, 134
AgsI TTSAA 1 cut(s) 149
AlwI GGATC 3 cut(s) 50, 129, 134
AoxI GGCC 1 cut(s) 3
ArsI GACNNNNNNTTYG 2 cut(s) 80, 112
AspLEI GCGC 1 cut(s) 53
BccI CCATC 1 cut(s) 112
BcgI CGANNNNNNTGC 2 cut(s) 47, 81
BmsI GCATC 1 cut(s) 55
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 5 cut(s) 42, 80, 112, 121, 126
BspANI GGCC 1 cut(s) 5
BspPI GGATC 3 cut(s) 50, 129, 134
BssMI GATC 5 cut(s) 42, 80, 112, 121, 126
BstC8I GCNNGC 1 cut(s) 49
BstHHI GCGC 1 cut(s) 53
BstKTI GATC 5 cut(s) 45, 83, 115, 124, 129
BstMBI GATC 5 cut(s) 42, 80, 112, 121, 126
BstX2I RGATCY 1 cut(s) 126
BstYI RGATCY 1 cut(s) 126
BsuRI GGCC 1 cut(s) 5
Cac8I GCNNGC 1 cut(s) 49
CfoI GCGC 1 cut(s) 53
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
DpnI GATC 5 cut(s) 44, 82, 114, 123, 128
DpnII GATC 5 cut(s) 42, 80, 112, 121, 126
GlaI GCGC 1 cut(s) 52
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 1 cut(s) 53
Hin6I GCGC 1 cut(s) 51
HinP1I GCGC 1 cut(s) 51
HinfI GANTC 1 cut(s) 88
Hpy188I TCNGA 3 cut(s) 38, 117, 126
Hpy99I CGWCG 1 cut(s) 38
HpyAV CCTTC 1 cut(s) 87
HpyCH4V TGCA 1 cut(s) 68
HspAI GCGC 1 cut(s) 51
Kzo9I GATC 5 cut(s) 42, 80, 112, 121, 126
LpnPI CCDG 1 cut(s) 61
LweI GCATC 1 cut(s) 55
MalI GATC 5 cut(s) 44, 82, 114, 123, 128
MboI GATC 5 cut(s) 42, 80, 112, 121, 126
MflI RGATCY 1 cut(s) 126
MmeI TCCRAC 1 cut(s) 16
MnlI CCTC 2 cut(s) 16, 32
NdeII GATC 5 cut(s) 42, 80, 112, 121, 126
PcsI WCGNNNNNNNCGW 1 cut(s) 69
PfeI GAWTC 1 cut(s) 88
PsuI RGATCY 1 cut(s) 126
Sau3AI GATC 5 cut(s) 42, 80, 112, 121, 126
SetI ASST 1 cut(s) 98
SfaNI GCATC 1 cut(s) 55
SgeI CNNG 3 cut(s) 31, 60, 83
TaqI TCGA 4 cut(s) 18, 72, 86, 91
TfiI GAWTC 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.