Rh5AG307400

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
44035549 .. 44040972
5424 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG307400.1

Sequence Viewer

Length: 213 bp
ATGAAAGCTATCACCCCAGCAGTCCTTGATAACAAGGCTCATTTGGGAATCATCTTTGATACAGACGTTGATAGTTTGACCTTTGGTGCAAACAACGCAGCCTATGAAGATCAAGCGTCATCTTCATCTGGAGGGGTTGACAAGCTCAACACATGTCATTATCCTATTTTCAGCTCCACTTCAGTTTCTACAGGTGAATGCAAATGCTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

7.4

Weight (kDa)

4.64

Isoelectric Point (pI)

43.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025027)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0046321
rosa_roxburghii Rroxscaffold_1G00035500
rosa_samantha Rh5AG307400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 165
AflIII ACRYGT 1 cut(s) 152
AluBI AGCT 3 cut(s) 8, 145, 174
AluI AGCT 3 cut(s) 8, 145, 174
ApeKI GCWGC 1 cut(s) 98
AsuHPI GGTGA 2 cut(s) 4, 206
BaeI ACNNNNGTAYC 2 cut(s) 51, 84
BbvI GCAGC 1 cut(s) 110
BfmI CTRYAG 1 cut(s) 189
BisI GCNGC 1 cut(s) 99
BlsI GCNGC 1 cut(s) 100
BpmI CTGGAG 1 cut(s) 150
BseXI GCAGC 1 cut(s) 110
BseYI CCCAGC 1 cut(s) 16
BsmI GAATGC 1 cut(s) 203
Bsp143I GATC 1 cut(s) 109
BssMI GATC 1 cut(s) 109
BstKTI GATC 1 cut(s) 112
BstMBI GATC 1 cut(s) 109
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstNSI RCATGY 1 cut(s) 156
BstSFI CTRYAG 1 cut(s) 189
BstV1I GCAGC 1 cut(s) 110
CseI GACGC 1 cut(s) 105
CviAII CATG 1 cut(s) 153
CviJI RGCY 5 cut(s) 8, 38, 101, 145, 174
CviKI_1 RGCY 5 cut(s) 8, 38, 101, 145, 174
DpnI GATC 1 cut(s) 111
DpnII GATC 1 cut(s) 109
Eco57I CTGAAG 1 cut(s) 165
FaeI CATG 1 cut(s) 156
FaiI YATR 2 cut(s) 105, 154
FatI CATG 1 cut(s) 152
Fnu4HI GCNGC 1 cut(s) 99
Fsp4HI GCNGC 1 cut(s) 99
GluI GCNGC 1 cut(s) 99
GsaI CCCAGC 1 cut(s) 20
GsuI CTGGAG 1 cut(s) 150
HgaI GACGC 1 cut(s) 105
Hin1II CATG 1 cut(s) 156
HincII GTYRAC 1 cut(s) 139
HindII GTYRAC 1 cut(s) 139
HinfI GANTC 1 cut(s) 48
HphI GGTGA 2 cut(s) 4, 206
Hpy166II GTNNAC 1 cut(s) 139
Hpy188III TCNNGA 1 cut(s) 129
Hpy8I GTNNAC 1 cut(s) 139
HpyCH4IV ACGT 1 cut(s) 66
HpyCH4V TGCA 2 cut(s) 89, 201
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
HpySE526I ACGT 1 cut(s) 66
Hsp92II CATG 1 cut(s) 156
Kzo9I GATC 1 cut(s) 109
LmnI GCTCC 1 cut(s) 179
LpnPI CCDG 4 cut(s) 30, 114, 177, 193
Lsp1109I GCAGC 1 cut(s) 110
MaeII ACGT 1 cut(s) 66
MalI GATC 1 cut(s) 111
MboI GATC 1 cut(s) 109
MboII GAAGA 2 cut(s) 114, 119
MnlI CCTC 1 cut(s) 125
Mva1269I GAATGC 1 cut(s) 203
MwoI GCNNNNNNNGC 1 cut(s) 95
NdeII GATC 1 cut(s) 109
NlaIII CATG 1 cut(s) 156
NspI RCATGY 1 cut(s) 156
PciI ACATGT 1 cut(s) 152
PctI GAATGC 1 cut(s) 203
PfeI GAWTC 1 cut(s) 48
PkrI GCNGC 1 cut(s) 100
PscI ACATGT 1 cut(s) 152
PspFI CCCAGC 1 cut(s) 16
SatI GCNGC 1 cut(s) 99
Sau3AI GATC 1 cut(s) 109
SetI ASST 6 cut(s) 10, 69, 83, 147, 176, 196
SfcI CTRYAG 1 cut(s) 189
SgeI CNNG 8 cut(s) 29, 38, 46, 125, 141, 154, 165, 204
TaiI ACGT 1 cut(s) 69
TfiI GAWTC 1 cut(s) 48
TseI GCWGC 1 cut(s) 98
TspDTI ATGAA 3 cut(s) 17, 114, 120
XceI RCATGY 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.