Rh5AG350800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0022667
Physical Location & Seq
Forward (+)
58090936 .. 58098383
7448 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG350800.1

Sequence Viewer

Length: 300 bp
ATGAAGATTCGGCCTCTGAGTAGTTTTGAAGAGTTTGAGTTTGAAGGAACAAGGGTTACAGCCTTCAGTGAAAACAACTCACCAGAGTCTATTGCACCGACGGAAGAAGAAGCTTTAGATAGATGTTCTACTGTAAAACTAGTAGATGTTCTACATGTGCCTCGTACAGAAGCAACTAGTTTTGGTCCTGCGTTTAATGAGGATTGGAAGCTTGAATCATGGCTGAAGATCTGGACAAACCGTTGTTGGATCCTGAGAATTTCAATAGAGATGGCATCGATTTGGAACGATTACCCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

11.54

Weight (kDa)

4.63

Isoelectric Point (pI)

50.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022667)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0131691
rosa_samantha Rh2BG358600 Rh5AG350800 Rh5DG377400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 244, 257
AcsI RAATTY 1 cut(s) 258
AcuI CTGAAG 2 cut(s) 49, 245
AfaI GTAC 1 cut(s) 166
AflIII ACRYGT 1 cut(s) 154
AgsI TTSAA 4 cut(s) 29, 44, 215, 264
AhlI ACTAGT 2 cut(s) 139, 176
AluBI AGCT 2 cut(s) 113, 211
AluI AGCT 2 cut(s) 113, 211
AlwI GGATC 2 cut(s) 244, 257
AoxI GGCC 1 cut(s) 11
ApoI RAATTY 1 cut(s) 258
AspS9I GGNCC 1 cut(s) 185
AsuHPI GGTGA 1 cut(s) 72
AvaII GGWCC 1 cut(s) 185
BamHI GGATCC 1 cut(s) 249
BccI CCATC 1 cut(s) 265
BcuI ACTAGT 2 cut(s) 139, 176
BfaI CTAG 2 cut(s) 140, 177
BglII AGATCT 1 cut(s) 228
Bme18I GGWCC 1 cut(s) 185
BmgT120I GGNCC 1 cut(s) 185
BmiI GGNNCC 1 cut(s) 251
BmsI GCATC 1 cut(s) 284
Bsa29I ATCGAT 1 cut(s) 278
BseCI ATCGAT 1 cut(s) 278
BseMII CTCAG 2 cut(s) 8, 245
BshFI GGCC 1 cut(s) 13
BshVI ATCGAT 1 cut(s) 278
BsnI GGCC 1 cut(s) 13
Bsp143I GATC 2 cut(s) 228, 249
BspANI GGCC 1 cut(s) 13
BspCNI CTCAG 2 cut(s) 9, 246
BspDI ATCGAT 1 cut(s) 278
BspLI GGNNCC 1 cut(s) 251
BspPI GGATC 2 cut(s) 244, 257
BssMI GATC 2 cut(s) 228, 249
Bst4CI ACNGT 2 cut(s) 133, 242
Bst6I CTCTTC 1 cut(s) 24
BstDEI CTNAG 2 cut(s) 17, 254
BstKTI GATC 2 cut(s) 231, 252
BstMBI GATC 2 cut(s) 228, 249
BstNSI RCATGY 1 cut(s) 158
BstX2I RGATCY 2 cut(s) 228, 249
BstYI RGATCY 2 cut(s) 228, 249
Bsu15I ATCGAT 1 cut(s) 278
BsuRI GGCC 1 cut(s) 13
BsuTUI ATCGAT 1 cut(s) 278
BtsIMutI CAGTG 1 cut(s) 73
Cfr13I GGNCC 1 cut(s) 185
ClaI ATCGAT 1 cut(s) 278
Csp6I GTAC 1 cut(s) 165
CviAII CATG 2 cut(s) 155, 219
CviJI RGCY 5 cut(s) 13, 62, 113, 211, 223
CviKI_1 RGCY 5 cut(s) 13, 62, 113, 211, 223
CviQI GTAC 1 cut(s) 165
DdeI CTNAG 2 cut(s) 17, 254
DpnI GATC 2 cut(s) 230, 251
DpnII GATC 2 cut(s) 228, 249
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
Eco47I GGWCC 1 cut(s) 185
Eco57I CTGAAG 2 cut(s) 49, 245
FaeI CATG 2 cut(s) 158, 222
FaiI YATR 2 cut(s) 156, 220
FatI CATG 2 cut(s) 154, 218
FspBI CTAG 2 cut(s) 140, 177
HaeIII GGCC 1 cut(s) 13
Hin1II CATG 2 cut(s) 158, 222
HindIII AAGCTT 2 cut(s) 111, 209
HinfI GANTC 3 cut(s) 7, 86, 215
HphI GGTGA 1 cut(s) 72
Hpy188I TCNGA 1 cut(s) 18
Hpy188III TCNNGA 2 cut(s) 232, 253
Hpy99I CGWCG 1 cut(s) 103
HpyAV CCTTC 2 cut(s) 38, 73
HpyCH4III ACNGT 2 cut(s) 133, 242
HpyCH4V TGCA 1 cut(s) 95
HpyF3I CTNAG 2 cut(s) 17, 254
Hsp92II CATG 2 cut(s) 158, 222
Kzo9I GATC 2 cut(s) 228, 249
LpnPI CCDG 4 cut(s) 96, 201, 217, 266
LweI GCATC 1 cut(s) 284
MaeI CTAG 2 cut(s) 140, 177
MaeIII GTNAC 1 cut(s) 55
MalI GATC 2 cut(s) 230, 251
MboI GATC 2 cut(s) 228, 249
MboII GAAGA 5 cut(s) 16, 41, 116, 119, 238
MflI RGATCY 2 cut(s) 228, 249
MluCI AATT 1 cut(s) 258
MlyI GAGTC 1 cut(s) 95
MmeI TCCRAC 1 cut(s) 227
MnlI CCTC 3 cut(s) 24, 171, 193
MseI TTAA 1 cut(s) 195
NdeII GATC 2 cut(s) 228, 249
NlaIII CATG 2 cut(s) 158, 222
NlaIV GGNNCC 1 cut(s) 251
NspI RCATGY 1 cut(s) 158
PciI ACATGT 1 cut(s) 154
PfeI GAWTC 2 cut(s) 7, 215
PleI GAGTC 1 cut(s) 94
PpsI GAGTC 1 cut(s) 94
PscI ACATGT 1 cut(s) 154
PspN4I GGNNCC 1 cut(s) 251
PspPI GGNCC 1 cut(s) 185
PsrI GAACNNNNNNTAC 2 cut(s) 40, 72
PsuI RGATCY 2 cut(s) 228, 249
RsaI GTAC 1 cut(s) 166
RsaNI GTAC 1 cut(s) 165
SaqAI TTAA 1 cut(s) 195
Sau3AI GATC 2 cut(s) 228, 249
Sau96I GGNCC 1 cut(s) 185
SchI GAGTC 1 cut(s) 95
SetI ASST 2 cut(s) 115, 213
SfaNI GCATC 1 cut(s) 284
SinI GGWCC 1 cut(s) 185
SpeI ACTAGT 2 cut(s) 139, 176
Sse9I AATT 1 cut(s) 258
SspMI CTAG 2 cut(s) 140, 177
TaaI ACNGT 2 cut(s) 133, 242
TaqI TCGA 1 cut(s) 278
TasI AATT 1 cut(s) 258
TfiI GAWTC 2 cut(s) 7, 215
Tru1I TTAA 1 cut(s) 195
Tru9I TTAA 1 cut(s) 195
TscAI CASTG 1 cut(s) 73
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 116
TspRI CASTG 1 cut(s) 73
VpaK11BI GGWCC 1 cut(s) 185
XapI RAATTY 1 cut(s) 258
XceI RCATGY 1 cut(s) 158
XspI CTAG 2 cut(s) 140, 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.