Rh5DG377400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
57442019 .. 57444678
2660 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG377400.1

Sequence Viewer

Length: 174 bp
ATGCCTCGGAATTGTTGGATTCATGAAGGAGAAGCTTTAGATGGATGTTCTACTGTAAAACTAGTAGATGTTCTACATGTGCCTCGTACAGAAGCAACTAGTTTTGGTCCTGCATTTAATGAGGTAATATATTGGTTTTTTTCTTCTCTTTCATTTTGCTTATTGCCAATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.45

Weight (kDa)

4.97

Isoelectric Point (pI)

35.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022667)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0131691
rosa_samantha Rh2BG358600 Rh5AG350800 Rh5DG377400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 88
AflIII ACRYGT 1 cut(s) 76
AhlI ACTAGT 2 cut(s) 61, 98
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
AspS9I GGNCC 1 cut(s) 107
AvaII GGWCC 1 cut(s) 107
BccI CCATC 1 cut(s) 35
BcuI ACTAGT 2 cut(s) 61, 98
BfaI CTAG 2 cut(s) 62, 99
Bme18I GGWCC 1 cut(s) 107
BmgT120I GGNCC 1 cut(s) 107
BsaJI CCNNGG 1 cut(s) 5
BseDI CCNNGG 1 cut(s) 5
BseGI GGATG 1 cut(s) 50
BspHI TCATGA 1 cut(s) 22
BssECI CCNNGG 1 cut(s) 5
Bst4CI ACNGT 1 cut(s) 55
BstF5I GGATG 1 cut(s) 50
BstNSI RCATGY 1 cut(s) 80
BtsCI GGATG 1 cut(s) 50
CciI TCATGA 1 cut(s) 22
Cfr13I GGNCC 1 cut(s) 107
Csp6I GTAC 1 cut(s) 87
CviAII CATG 2 cut(s) 23, 77
CviJI RGCY 1 cut(s) 35
CviKI_1 RGCY 1 cut(s) 35
CviQI GTAC 1 cut(s) 87
Eco47I GGWCC 1 cut(s) 107
FaeI CATG 2 cut(s) 26, 80
FaiI YATR 4 cut(s) 24, 78, 130, 172
FatI CATG 2 cut(s) 22, 76
FokI GGATG 1 cut(s) 57
FspBI CTAG 2 cut(s) 62, 99
FspEI CC 8 cut(s) 12, 18, 27, 90, 96, 107, 118, 123
Hin1II CATG 2 cut(s) 26, 80
HindIII AAGCTT 1 cut(s) 33
HinfI GANTC 1 cut(s) 19
Hpy188I TCNGA 1 cut(s) 9
Hpy188III TCNNGA 1 cut(s) 23
HpyAV CCTTC 1 cut(s) 20
HpyCH4III ACNGT 1 cut(s) 55
HpyCH4V TGCA 1 cut(s) 113
Hsp92II CATG 2 cut(s) 26, 80
LpnPI CCDG 1 cut(s) 123
MaeI CTAG 2 cut(s) 62, 99
MboII GAAGA 1 cut(s) 135
MluCI AATT 1 cut(s) 10
MnlI CCTC 3 cut(s) 15, 93, 115
MseI TTAA 1 cut(s) 117
NlaIII CATG 2 cut(s) 26, 80
NspI RCATGY 1 cut(s) 80
PagI TCATGA 1 cut(s) 22
PciI ACATGT 1 cut(s) 76
PfeI GAWTC 1 cut(s) 19
PscI ACATGT 1 cut(s) 76
PspPI GGNCC 1 cut(s) 107
RsaI GTAC 1 cut(s) 88
RsaNI GTAC 1 cut(s) 87
SaqAI TTAA 1 cut(s) 117
Sau96I GGNCC 1 cut(s) 107
SetI ASST 2 cut(s) 37, 126
SgeI CNNG 7 cut(s) 18, 35, 74, 89, 96, 111, 122
SinI GGWCC 1 cut(s) 107
SpeI ACTAGT 2 cut(s) 61, 98
Sse9I AATT 1 cut(s) 10
SspMI CTAG 2 cut(s) 62, 99
TaaI ACNGT 1 cut(s) 55
TasI AATT 1 cut(s) 10
TfiI GAWTC 1 cut(s) 19
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TspDTI ATGAA 3 cut(s) 11, 39, 141
VpaK11BI GGWCC 1 cut(s) 107
XceI RCATGY 1 cut(s) 80
XspI CTAG 2 cut(s) 62, 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.