Rh5BG427200

Esterifies acyl-group from acyl-ACP to the sn-1 position of glycerol-3-phosphate. The enzyme from chilling-resistant plants discriminates against non-fluid palmitic acid and selects oleic acid whereas the enzyme from sensitive plants accepts both fatty acids

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
69126842 .. 69130951
4110 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG427200.1

Sequence Viewer

Length: 195 bp
ATGGCAGCTTCAGGAGAAGGTCACAACATTATTTTGATATCAAATCACCAAACTAAAGCAGATCCAGCTGTCATTGCCTTGTTACTTGAAACAACAAACCCACATCTTGCTAAGAAAATGACCTGCATAGCAGGAGATATAGTTGTGACAGATCCTCTTTGCAAGCCTTCAGCATTGGAAGACTTTAGTGTCTAG

Protein Analysis

64

Amino Acids

6.73

Weight (kDa)

5.33

Isoelectric Point (pI)

28.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Acyltransferase PF01553 6 - 56 1.2e-06 Acyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030156)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0062811
rosa_samantha Rh5BG427200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 188
Acc36I ACCTGC 1 cut(s) 131
AclWI GGATC 2 cut(s) 56, 146
AcuI CTGAAG 1 cut(s) 153
AgsI TTSAA 1 cut(s) 89
AluBI AGCT 2 cut(s) 8, 68
AluI AGCT 2 cut(s) 8, 68
AlwI GGATC 2 cut(s) 56, 146
ApeKI GCWGC 1 cut(s) 5
AsuHPI GGTGA 1 cut(s) 38
BbsI GAAGAC 1 cut(s) 186
BbvI GCAGC 1 cut(s) 17
BfaI CTAG 1 cut(s) 193
BfuAI ACCTGC 1 cut(s) 131
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
BpiI GAAGAC 1 cut(s) 186
BsaXI ACNNNNNCTCC 2 cut(s) 126, 156
Bse3DI GCAATG 1 cut(s) 72
BseMI GCAATG 1 cut(s) 72
BseXI GCAGC 1 cut(s) 17
Bsp143I GATC 2 cut(s) 61, 151
BspMI ACCTGC 1 cut(s) 131
BspPI GGATC 2 cut(s) 56, 146
BsrDI GCAATG 1 cut(s) 72
BssMI GATC 2 cut(s) 61, 151
BstC8I GCNNGC 1 cut(s) 164
BstDEI CTNAG 1 cut(s) 111
BstKTI GATC 2 cut(s) 64, 154
BstMBI GATC 2 cut(s) 61, 151
BstMWI GCNNNNNNNGC 2 cut(s) 65, 74
BstV1I GCAGC 1 cut(s) 17
BstV2I GAAGAC 1 cut(s) 186
BstX2I RGATCY 2 cut(s) 61, 151
BstYI RGATCY 2 cut(s) 61, 151
BveI ACCTGC 1 cut(s) 131
Cac8I GCNNGC 1 cut(s) 164
CviJI RGCY 3 cut(s) 8, 68, 166
CviKI_1 RGCY 3 cut(s) 8, 68, 166
DdeI CTNAG 1 cut(s) 111
DpnI GATC 2 cut(s) 63, 153
DpnII GATC 2 cut(s) 61, 151
DrdI GACNNNNNNGTC 1 cut(s) 188
DseDI GACNNNNNNGTC 1 cut(s) 188
Eco32I GATATC 1 cut(s) 39
Eco57I CTGAAG 1 cut(s) 153
EcoRV GATATC 1 cut(s) 39
FaiI YATR 2 cut(s) 128, 140
Fnu4HI GCNGC 1 cut(s) 6
Fsp4HI GCNGC 1 cut(s) 6
FspBI CTAG 1 cut(s) 193
GluI GCNGC 1 cut(s) 6
HphI GGTGA 1 cut(s) 38
Hpy188III TCNNGA 1 cut(s) 12
HpyAV CCTTC 2 cut(s) 11, 177
HpyCH4V TGCA 2 cut(s) 126, 162
HpyF10VI GCNNNNNNNGC 2 cut(s) 65, 74
HpyF3I CTNAG 1 cut(s) 111
Kzo9I GATC 2 cut(s) 61, 151
LpnPI CCDG 3 cut(s) 78, 117, 136
Lsp1109I GCAGC 1 cut(s) 17
MaeI CTAG 1 cut(s) 193
MaeIII GTNAC 3 cut(s) 20, 81, 145
MalI GATC 2 cut(s) 63, 153
MboI GATC 2 cut(s) 61, 151
MboII GAAGA 1 cut(s) 191
MflI RGATCY 2 cut(s) 61, 151
MnlI CCTC 1 cut(s) 165
MspA1I CMGCKG 1 cut(s) 68
MwoI GCNNNNNNNGC 2 cut(s) 65, 74
NdeII GATC 2 cut(s) 61, 151
NmuCI GTSAC 2 cut(s) 20, 145
PkrI GCNGC 1 cut(s) 7
PsuI RGATCY 2 cut(s) 61, 151
PvuII CAGCTG 1 cut(s) 68
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 2 cut(s) 61, 151
SetI ASST 4 cut(s) 10, 22, 70, 125
SgeI CNNG 8 cut(s) 24, 77, 91, 98, 119, 135, 144, 175
SspMI CTAG 1 cut(s) 193
TseFI GTSAC 2 cut(s) 20, 145
TseI GCWGC 1 cut(s) 5
Tsp45I GTSAC 2 cut(s) 20, 145
XspI CTAG 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.