Rh5CG186900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0025738
Physical Location & Seq
Forward (+)
18666532 .. 18666927
396 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG186900.1

Sequence Viewer

Length: 396 bp
ATGTACTCATCGGTCATCAGCTCCAGGTCCAAGGTACAAATACTTGAAGTTTTGGCTATGATTTCCCCCTTTGAACCTTCCATCACTATCACCTTAGCCTTTCATCATACTGTCCACCTTTCCAGGATCTCCATCATTCCAGAGACAGTGTCGCCACATCTTCTTCGCTCACTGATCTCACTCCCATCACACCTTCCCCATCAAAATCAGAACTTTTACATGTCATCTGTTGATGAAATTTCTGATTCATTTCCTATACCATATCCTGGCCTTTTTGGCAGAGGTAATTGCACACTTTTAATTGTCAACATAGATATCACATCTGACATGGTTGGCCGATCATCTGCATTTGCCCCCACACATAGTAGACCAACATGCAAGCATCTTAAGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

131

Amino Acids

14.54

Weight (kDa)

7.92

Isoelectric Point (pI)

67.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025738)

Species Orthologous Gene IDs
rosa_roxburghii Rroxscaffold_1G00054510
rosa_samantha Rh5CG186900 Rh5CG521300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 266
AccI GTMKAC 1 cut(s) 367
AclWI GGATC 1 cut(s) 134
AcoI YGGCCR 1 cut(s) 334
AcsI RAATTY 1 cut(s) 237
AfaI GTAC 2 cut(s) 5, 36
AfiI CCNNNNNNNGG 1 cut(s) 266
AflII CTTAAG 1 cut(s) 386
AflIII ACRYGT 1 cut(s) 219
AgsI TTSAA 2 cut(s) 47, 74
AjnI CCWGG 3 cut(s) 23, 122, 265
AluBI AGCT 1 cut(s) 21
AluI AGCT 1 cut(s) 21
Alw26I GTCTC 1 cut(s) 137
AlwI GGATC 1 cut(s) 134
AoxI GGCC 2 cut(s) 268, 334
ApoI RAATTY 1 cut(s) 237
AspS9I GGNCC 1 cut(s) 27
AsuHPI GGTGA 1 cut(s) 82
AvaII GGWCC 1 cut(s) 27
BccI CCATC 4 cut(s) 89, 140, 193, 207
BciT130I CCWGG 3 cut(s) 25, 124, 267
BcoDI GTCTC 1 cut(s) 137
BfrI CTTAAG 1 cut(s) 386
BglI GCCNNNNNGGC 1 cut(s) 276
Bme1390I CCNGG 3 cut(s) 25, 124, 267
Bme18I GGWCC 1 cut(s) 27
BmgT120I GGNCC 1 cut(s) 27
BmrFI CCNGG 3 cut(s) 25, 124, 267
BmsI GCATC 1 cut(s) 391
BpmI CTGGAG 1 cut(s) 7
Bpu10I CCTNAGC 1 cut(s) 94
BsaBI GATNNNNATC 1 cut(s) 131
BsaJI CCNNGG 1 cut(s) 30
Bsc4I CCNNNNNNNGG 1 cut(s) 266
Bse8I GATNNNNATC 1 cut(s) 131
BseBI CCWGG 3 cut(s) 25, 124, 267
BseDI CCNNGG 1 cut(s) 30
BseJI GATNNNNATC 1 cut(s) 131
BseLI CCNNNNNNNGG 1 cut(s) 266
BshFI GGCC 2 cut(s) 270, 336
BslI CCNNNNNNNGG 1 cut(s) 266
BsmAI GTCTC 1 cut(s) 137
BsnI GGCC 2 cut(s) 270, 336
Bsp143I GATC 3 cut(s) 126, 174, 338
BspANI GGCC 2 cut(s) 270, 336
BspPI GGATC 1 cut(s) 134
BspTI CTTAAG 1 cut(s) 386
BssECI CCNNGG 1 cut(s) 30
BssMI GATC 3 cut(s) 126, 174, 338
BssT1I CCWWGG 1 cut(s) 30
Bst2UI CCWGG 3 cut(s) 25, 124, 267
Bst4CI ACNGT 2 cut(s) 112, 148
BstAFI CTTAAG 1 cut(s) 386
BstC8I GCNNGC 1 cut(s) 380
BstDEI CTNAG 1 cut(s) 94
BstKTI GATC 3 cut(s) 129, 177, 341
BstMAI GTCTC 1 cut(s) 137
BstMBI GATC 3 cut(s) 126, 174, 338
BstMWI GCNNNNNNNGC 1 cut(s) 276
BstNI CCWGG 3 cut(s) 25, 124, 267
BstNSI RCATGY 2 cut(s) 223, 378
BstSCI CCNGG 3 cut(s) 23, 122, 265
BstX2I RGATCY 1 cut(s) 126
BstYI RGATCY 1 cut(s) 126
BsuRI GGCC 2 cut(s) 270, 336
BtsIMutI CAGTG 2 cut(s) 153, 170
Cac8I GCNNGC 1 cut(s) 380
Cfr13I GGNCC 1 cut(s) 27
Csp6I GTAC 2 cut(s) 4, 35
CviAII CATG 3 cut(s) 220, 328, 375
CviJI RGCY 5 cut(s) 21, 56, 98, 270, 336
CviKI_1 RGCY 5 cut(s) 21, 56, 98, 270, 336
CviQI GTAC 2 cut(s) 4, 35
DdeI CTNAG 1 cut(s) 94
DpnI GATC 3 cut(s) 128, 176, 340
DpnII GATC 3 cut(s) 126, 174, 338
EaeI YGGCCR 1 cut(s) 334
Eco130I CCWWGG 1 cut(s) 30
Eco32I GATATC 1 cut(s) 316
Eco47I GGWCC 1 cut(s) 27
EcoRII CCWGG 3 cut(s) 23, 122, 265
EcoRV GATATC 1 cut(s) 316
EcoT14I CCWWGG 1 cut(s) 30
ErhI CCWWGG 1 cut(s) 30
FaeI CATG 3 cut(s) 223, 331, 378
FaiI YATR 9 cut(s) 59, 108, 221, 257, 262, 311, 329, 363, 376
FatI CATG 3 cut(s) 219, 327, 374
FblI GTMKAC 1 cut(s) 367
GsuI CTGGAG 1 cut(s) 7
HaeIII GGCC 2 cut(s) 270, 336
Hin1II CATG 3 cut(s) 223, 331, 378
HincII GTYRAC 1 cut(s) 307
HindII GTYRAC 1 cut(s) 307
HinfI GANTC 1 cut(s) 245
HphI GGTGA 1 cut(s) 82
Hpy166II GTNNAC 3 cut(s) 115, 307, 368
Hpy188I TCNGA 3 cut(s) 210, 244, 325
Hpy188III TCNNGA 1 cut(s) 140
Hpy8I GTNNAC 3 cut(s) 115, 307, 368
HpyAV CCTTC 2 cut(s) 87, 203
HpyCH4III ACNGT 2 cut(s) 112, 148
HpyCH4V TGCA 3 cut(s) 291, 347, 378
HpyF10VI GCNNNNNNNGC 1 cut(s) 276
HpyF3I CTNAG 1 cut(s) 94
Hsp92II CATG 3 cut(s) 223, 331, 378
Kzo9I GATC 3 cut(s) 126, 174, 338
LmnI GCTCC 1 cut(s) 26
LpnPI CCDG 7 cut(s) 10, 37, 109, 136, 153, 252, 279
LweI GCATC 1 cut(s) 391
MalI GATC 3 cut(s) 128, 176, 340
MboI GATC 3 cut(s) 126, 174, 338
MboII GAAGA 2 cut(s) 152, 155
MflI RGATCY 1 cut(s) 126
MluCI AATT 4 cut(s) 237, 286, 300, 391
MnlI CCTC 1 cut(s) 275
MseI TTAA 2 cut(s) 299, 387
MspCI CTTAAG 1 cut(s) 386
MspR9I CCNGG 3 cut(s) 25, 124, 267
MvaI CCWGG 3 cut(s) 25, 124, 267
MwoI GCNNNNNNNGC 1 cut(s) 276
NdeII GATC 3 cut(s) 126, 174, 338
NlaIII CATG 3 cut(s) 223, 331, 378
NspI RCATGY 2 cut(s) 223, 378
PciI ACATGT 1 cut(s) 219
PfeI GAWTC 1 cut(s) 245
PflFI GACNNNGTC 1 cut(s) 148
PflMI CCANNNNNTGG 1 cut(s) 266
PfoI TCCNGGA 1 cut(s) 122
PscI ACATGT 1 cut(s) 219
Psp6I CCWGG 3 cut(s) 23, 122, 265
PspGI CCWGG 3 cut(s) 23, 122, 265
PspPI GGNCC 1 cut(s) 27
PsuI RGATCY 1 cut(s) 126
PsyI GACNNNGTC 1 cut(s) 148
RsaI GTAC 2 cut(s) 5, 36
RsaNI GTAC 2 cut(s) 4, 35
SaqAI TTAA 2 cut(s) 299, 387
Sau3AI GATC 3 cut(s) 126, 174, 338
Sau96I GGNCC 1 cut(s) 27
ScrFI CCNGG 3 cut(s) 25, 124, 267
SetI ASST 8 cut(s) 23, 29, 36, 79, 95, 120, 195, 286
SfaNI GCATC 1 cut(s) 391
SinI GGWCC 1 cut(s) 27
SmlI CTYRAG 1 cut(s) 386
SmoI CTYRAG 1 cut(s) 386
Sse9I AATT 4 cut(s) 237, 286, 300, 391
StyD4I CCNGG 3 cut(s) 23, 122, 265
StyI CCWWGG 1 cut(s) 30
TaaI ACNGT 2 cut(s) 112, 148
TasI AATT 4 cut(s) 237, 286, 300, 391
TatI WGTACW 1 cut(s) 3
TfiI GAWTC 1 cut(s) 245
Tru1I TTAA 2 cut(s) 299, 387
Tru9I TTAA 2 cut(s) 299, 387
TscAI CASTG 2 cut(s) 153, 177
TspDTI ATGAA 3 cut(s) 92, 237, 249
TspRI CASTG 2 cut(s) 153, 177
Tth111I GACNNNGTC 1 cut(s) 148
Van91I CCANNNNNTGG 1 cut(s) 266
Vha464I CTTAAG 1 cut(s) 386
VpaK11BI GGWCC 1 cut(s) 27
XapI RAATTY 1 cut(s) 237
XceI RCATGY 2 cut(s) 223, 378
XmiI GTMKAC 1 cut(s) 367
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.