Rh5CG281800

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
30754680 .. 30755096
417 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG281800.1

Sequence Viewer

Length: 417 bp
ATGTGGAGTGGCACAACAAATATCAATCCCATCATTTACTCAGCTCCAGCAAATCAGTGTGACGCTTATAATGTGTGCGGTGCATTTGCTCTCTGCAGTGTTGATTCTCCTCAAGGTTTTGCACCAAATTCTTCAACGTCCACCAGGTGTCTTAGTAGAAATCCATTGAGTTGCAATGATTACCAAGATGGCTTTAAGAAGTTCACAAGTGTGAAATTGCCGGACACATCTTCGTCCTGGTTTTACTTGGCAATGACCCTTGAGTACTGTGAGAAAATTTGTTTGAAGAACTGCACTTGCACTGCTTATGCAAATTTGGATGTAAGGGAAGGAAGAAGTGGTTGTTTGCTCTGGTTTGATGAACTCAATGACATACAAGAATTCGCTAATGGTGGGCAAGACCTATTTGTAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

138

Amino Acids

15.28

Weight (kDa)

4.47

Isoelectric Point (pI)

47.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
S_locus_glycop PF00954 10 - 36 7.1e-06 S-locus glycoprotein domain
PAN_2 PF08276 58 - 125 2.2e-20 PAN-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0032386)

Species Orthologous Gene IDs
rosa_rugosa Rorug05G0156200
rosa_samantha Rh5CG281800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 69
AciI CCGC 1 cut(s) 78
AcsI RAATTY 4 cut(s) 127, 276, 313, 380
AdeI CACNNNGTG 1 cut(s) 147
AfaI GTAC 1 cut(s) 266
AgsI TTSAA 2 cut(s) 135, 286
AjnI CCWGG 2 cut(s) 143, 236
AleI CACNNNNGTG 1 cut(s) 209
AluBI AGCT 1 cut(s) 44
AluI AGCT 1 cut(s) 44
ApoI RAATTY 4 cut(s) 127, 276, 313, 380
BccI CCATC 2 cut(s) 38, 182
BciT130I CCWGG 2 cut(s) 145, 238
BfmI CTRYAG 1 cut(s) 94
BmcAI AGTACT 1 cut(s) 266
Bme1390I CCNGG 2 cut(s) 145, 238
BmrFI CCNGG 2 cut(s) 145, 238
BpmI CTGGAG 1 cut(s) 30
BpuEI CTTGAG 2 cut(s) 96, 281
Bse3DI GCAATG 2 cut(s) 181, 258
BseBI CCWGG 2 cut(s) 145, 238
BseGI GGATG 1 cut(s) 325
BseMI GCAATG 2 cut(s) 181, 258
BseMII CTCAG 1 cut(s) 54
BseRI GAGGAG 1 cut(s) 99
BsgI GTGCAG 1 cut(s) 277
BsiSI CCGG 1 cut(s) 221
BspACI CCGC 1 cut(s) 78
BspCNI CTCAG 1 cut(s) 53
BspMAI CTGCAG 1 cut(s) 98
BsrDI GCAATG 2 cut(s) 181, 258
Bst2UI CCWGG 2 cut(s) 145, 238
Bst4CI ACNGT 1 cut(s) 269
BstDEI CTNAG 2 cut(s) 40, 152
BstF5I GGATG 1 cut(s) 325
BstNI CCWGG 2 cut(s) 145, 238
BstSCI CCNGG 2 cut(s) 143, 236
BstSFI CTRYAG 1 cut(s) 94
BtsCI GGATG 1 cut(s) 325
BtsI GCAGTG 2 cut(s) 103, 300
BtsIMutI CAGTG 3 cut(s) 62, 103, 300
CseI GACGC 1 cut(s) 71
CsiI ACCWGGT 1 cut(s) 143
Csp6I GTAC 1 cut(s) 265
CviJI RGCY 2 cut(s) 44, 192
CviKI_1 RGCY 2 cut(s) 44, 192
CviQI GTAC 1 cut(s) 265
DdeI CTNAG 2 cut(s) 40, 152
DraIII CACNNNGTG 1 cut(s) 147
EcoRI GAATTC 1 cut(s) 380
EcoRII CCWGG 2 cut(s) 143, 236
FaiI YATR 3 cut(s) 69, 309, 374
FokI GGATG 1 cut(s) 332
GsuI CTGGAG 1 cut(s) 30
HapII CCGG 1 cut(s) 221
HgaI GACGC 1 cut(s) 71
HinfI GANTC 1 cut(s) 104
HpaII CCGG 1 cut(s) 221
Hpy166II GTNNAC 2 cut(s) 141, 204
Hpy8I GTNNAC 2 cut(s) 141, 204
HpyAV CCTTC 1 cut(s) 323
HpyCH4III ACNGT 1 cut(s) 269
HpyCH4IV ACGT 1 cut(s) 137
HpyCH4V TGCA 7 cut(s) 83, 96, 122, 174, 294, 300, 311
HpyF3I CTNAG 2 cut(s) 40, 152
HpySE526I ACGT 1 cut(s) 137
LmnI GCTCC 1 cut(s) 49
LpnPI CCDG 7 cut(s) 60, 130, 157, 223, 234, 250, 337
MabI ACCWGGT 1 cut(s) 143
MaeII ACGT 1 cut(s) 137
MaeIII GTNAC 1 cut(s) 59
MboII GAAGA 4 cut(s) 123, 222, 298, 345
MluCI AATT 6 cut(s) 127, 215, 276, 313, 380, 412
MnlI CCTC 1 cut(s) 120
MseI TTAA 2 cut(s) 195, 415
MslI CAYNNNNRTG 1 cut(s) 209
MspI CCGG 1 cut(s) 221
MspR9I CCNGG 2 cut(s) 145, 238
MvaI CCWGG 2 cut(s) 145, 238
NmuCI GTSAC 1 cut(s) 59
OliI CACNNNNGTG 1 cut(s) 209
PfeI GAWTC 1 cut(s) 104
PsiI TTATAA 1 cut(s) 69
Psp6I CCWGG 2 cut(s) 143, 236
PspGI CCWGG 2 cut(s) 143, 236
PstI CTGCAG 1 cut(s) 98
RsaI GTAC 1 cut(s) 266
RsaNI GTAC 1 cut(s) 265
RseI CAYNNNNRTG 1 cut(s) 209
SaqAI TTAA 2 cut(s) 195, 415
ScaI AGTACT 1 cut(s) 266
ScrFI CCNGG 2 cut(s) 145, 238
SetI ASST 5 cut(s) 46, 118, 140, 149, 405
SexAI ACCWGGT 1 cut(s) 143
SfcI CTRYAG 1 cut(s) 94
SmiMI CAYNNNNRTG 1 cut(s) 209
SmlI CTYRAG 2 cut(s) 111, 260
SmoI CTYRAG 2 cut(s) 111, 260
Sse9I AATT 6 cut(s) 127, 215, 276, 313, 380, 412
SsiI CCGC 1 cut(s) 78
StyD4I CCNGG 2 cut(s) 143, 236
TaaI ACNGT 1 cut(s) 269
TaiI ACGT 1 cut(s) 140
TasI AATT 6 cut(s) 127, 215, 276, 313, 380, 412
TatI WGTACW 1 cut(s) 264
TfiI GAWTC 1 cut(s) 104
Tru1I TTAA 2 cut(s) 195, 415
Tru9I TTAA 2 cut(s) 195, 415
TscAI CASTG 3 cut(s) 62, 103, 307
TseFI GTSAC 1 cut(s) 59
Tsp45I GTSAC 1 cut(s) 59
TspDTI ATGAA 1 cut(s) 375
TspRI CASTG 3 cut(s) 62, 103, 307
XapI RAATTY 4 cut(s) 127, 276, 313, 380
ZrmI AGTACT 1 cut(s) 266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.