Rh6AG137700

Cysteine-rich receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
21062208 .. 21064801
2594 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG137700.1

Sequence Viewer

Length: 246 bp
ATGATCGAACTTCTTAGATTAAGAAACACACGCAATAGATATCTTATTCCGGCCGGCTGTAGAAGAGTAAAAAAGACGACGCACAATGCCCAGCCACAACAAAACAGTATTAACATCACCATCGAGGCCTTGCAATTTGACTTGGCAACTATCCAGATTGCGACAAATAAATTTTCTAGCGAAAATAAGTTAGGTCAAGGCGGTTTTGGTGAAGTTTTCAAGGAACTAATCACCATGATCAAATAA

Protein Analysis

81

Amino Acids

9.23

Weight (kDa)

10.12

Isoelectric Point (pI)

60.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0033602)

Species Orthologous Gene IDs
rosa_samantha Rh6AG137700 Rh6BG136200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 201
AcoI YGGCCR 1 cut(s) 51
AcsI RAATTY 1 cut(s) 170
AgsI TTSAA 1 cut(s) 220
AoxI GGCC 2 cut(s) 51, 126
ApoI RAATTY 1 cut(s) 170
AsuHPI GGTGA 3 cut(s) 109, 221, 223
BccI CCATC 1 cut(s) 128
BclI TGATCA 1 cut(s) 237
BfaI CTAG 1 cut(s) 177
BfmI CTRYAG 1 cut(s) 58
Bse118I RCCGGY 1 cut(s) 53
BseX3I CGGCCG 1 cut(s) 51
BseYI CCCAGC 1 cut(s) 90
Bsh1285I CGRYCG 1 cut(s) 54
BshFI GGCC 2 cut(s) 53, 128
BsiEI CGRYCG 1 cut(s) 54
BsiSI CCGG 2 cut(s) 50, 54
BsnI GGCC 2 cut(s) 53, 128
Bsp143I GATC 2 cut(s) 3, 237
BspACI CCGC 1 cut(s) 201
BspANI GGCC 2 cut(s) 53, 128
BsrFI RCCGGY 1 cut(s) 53
BssAI RCCGGY 1 cut(s) 53
BssMI GATC 2 cut(s) 3, 237
Bst4CI ACNGT 1 cut(s) 107
Bst6I CTCTTC 1 cut(s) 58
BstC8I GCNNGC 1 cut(s) 55
BstDEI CTNAG 1 cut(s) 14
BstKTI GATC 2 cut(s) 6, 240
BstMBI GATC 2 cut(s) 3, 237
BstMCI CGRYCG 1 cut(s) 54
BstSFI CTRYAG 1 cut(s) 58
BstZI CGGCCG 1 cut(s) 51
BsuRI GGCC 2 cut(s) 53, 128
Cac8I GCNNGC 1 cut(s) 55
Cfr10I RCCGGY 1 cut(s) 53
CseI GACGC 1 cut(s) 88
CviAII CATG 1 cut(s) 235
CviJI RGCY 4 cut(s) 53, 57, 94, 128
CviKI_1 RGCY 4 cut(s) 53, 57, 94, 128
DdeI CTNAG 1 cut(s) 14
DpnI GATC 2 cut(s) 5, 239
DpnII GATC 2 cut(s) 3, 237
EaeI YGGCCR 1 cut(s) 51
EagI CGGCCG 1 cut(s) 51
Eam1104I CTCTTC 1 cut(s) 58
EarI CTCTTC 1 cut(s) 58
EclXI CGGCCG 1 cut(s) 51
Eco147I AGGCCT 1 cut(s) 128
Eco32I GATATC 1 cut(s) 41
Eco52I CGGCCG 1 cut(s) 51
EcoRV GATATC 1 cut(s) 41
FaeI CATG 1 cut(s) 238
FaiI YATR 1 cut(s) 236
FatI CATG 1 cut(s) 234
FbaI TGATCA 1 cut(s) 237
FspBI CTAG 1 cut(s) 177
GsaI CCCAGC 1 cut(s) 94
HaeIII GGCC 2 cut(s) 53, 128
HapII CCGG 2 cut(s) 50, 54
HgaI GACGC 1 cut(s) 88
Hin1II CATG 1 cut(s) 238
HpaII CCGG 2 cut(s) 50, 54
HphI GGTGA 3 cut(s) 109, 221, 223
Hpy188III TCNNGA 1 cut(s) 154
Hpy99I CGWCG 1 cut(s) 82
HpyCH4III ACNGT 1 cut(s) 107
HpyCH4V TGCA 1 cut(s) 133
HpyF3I CTNAG 1 cut(s) 14
Hsp92II CATG 1 cut(s) 238
KroI GCCGGC 1 cut(s) 53
KroNI GCCGGC 1 cut(s) 55
Ksp22I TGATCA 1 cut(s) 237
Kzo9I GATC 2 cut(s) 3, 237
LpnPI CCDG 4 cut(s) 63, 67, 104, 167
MaeI CTAG 1 cut(s) 177
MalI GATC 2 cut(s) 5, 239
MboI GATC 2 cut(s) 3, 237
MboII GAAGA 1 cut(s) 75
MluCI AATT 2 cut(s) 134, 170
MnlI CCTC 1 cut(s) 118
MroNI GCCGGC 1 cut(s) 53
MseI TTAA 2 cut(s) 20, 111
MspI CCGG 2 cut(s) 50, 54
NaeI GCCGGC 1 cut(s) 55
NdeII GATC 2 cut(s) 3, 237
NgoMIV GCCGGC 1 cut(s) 53
NlaIII CATG 1 cut(s) 238
PceI AGGCCT 1 cut(s) 128
PdiI GCCGGC 1 cut(s) 55
PspFI CCCAGC 1 cut(s) 90
SaqAI TTAA 2 cut(s) 20, 111
Sau3AI GATC 2 cut(s) 3, 237
SetI ASST 1 cut(s) 196
SfcI CTRYAG 1 cut(s) 58
Sse9I AATT 2 cut(s) 134, 170
SseBI AGGCCT 1 cut(s) 128
SsiI CCGC 1 cut(s) 201
SspMI CTAG 1 cut(s) 177
StuI AGGCCT 1 cut(s) 128
TaaI ACNGT 1 cut(s) 107
TaqI TCGA 2 cut(s) 6, 123
TasI AATT 2 cut(s) 134, 170
Tru1I TTAA 2 cut(s) 20, 111
Tru9I TTAA 2 cut(s) 20, 111
XapI RAATTY 1 cut(s) 170
XspI CTAG 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.