Rh6AG458500

Bark storage protein A-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0030398
Physical Location & Seq
Forward (+)
64169581 .. 64170526
946 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG458500.1

Sequence Viewer

Length: 372 bp
ATGAGAATTTCAGTAGTAGCTTGGCCTTGCGTAGCTGTTTACGCTATGATCATCAGCTTGATGCTTAAACACACAAATGATGCATTGTCTGCAGATACGCAGAAGTTGATCGACCAGGCCAACAAGAGTGGCCCTTACTTGGGCTTGGTAATTCTGAATTCTTTCGAACTGGACCCTCTTCTTCAATCTCCAAACTTCACTTCAACAAACTTGATCATAGATTTTTCCGGAAGGAGATTTCGGTTTGGAACCATTACTGAAAAGAAAGTCATCTTAGTCATGACAGGAGTTTCCAGTCCATGTATTAGTCCCATAGAGCTCTTTGGAATTGGCAGAGATATGGAAACGGGCCTCAAGATGAACTACTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PNP_UDP_1

Protein Analysis

123

Amino Acids

13.59

Weight (kDa)

7.77

Isoelectric Point (pI)

31.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030398)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0306031
rosa_samantha Rh6AG458500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 227
AcsI RAATTY 2 cut(s) 6, 157
AfiI CCNNNNNNNGG 2 cut(s) 139, 140
AgsI TTSAA 2 cut(s) 185, 204
AjnI CCWGG 1 cut(s) 114
AjuI GAANNNNNNNTTGG 2 cut(s) 184, 216
AluBI AGCT 4 cut(s) 20, 35, 57, 319
AluI AGCT 4 cut(s) 20, 35, 57, 319
Alw21I GWGCWC 1 cut(s) 321
Aor13HI TCCGGA 1 cut(s) 227
AoxI GGCC 4 cut(s) 23, 117, 130, 349
ApoI RAATTY 2 cut(s) 6, 157
Asp700I GAANNNNTTC 1 cut(s) 161
AspS9I GGNCC 3 cut(s) 131, 172, 349
AsuII TTCGAA 1 cut(s) 165
AvaII GGWCC 1 cut(s) 172
BanII GRGCYC 1 cut(s) 321
Bbv12I GWGCWC 1 cut(s) 321
BciT130I CCWGG 1 cut(s) 116
BclI TGATCA 2 cut(s) 48, 213
BfmI CTRYAG 1 cut(s) 90
Bme1390I CCNGG 1 cut(s) 116
Bme18I GGWCC 1 cut(s) 172
BmgT120I GGNCC 3 cut(s) 131, 172, 349
BmiI GGNNCC 2 cut(s) 174, 250
BmrFI CCNGG 1 cut(s) 116
BmsI GCATC 2 cut(s) 51, 70
Bpu14I TTCGAA 1 cut(s) 165
BpuEI CTTGAG 1 cut(s) 338
BsaWI WCCGGW 1 cut(s) 227
Bsc4I CCNNNNNNNGG 2 cut(s) 139, 140
Bse1I ACTGG 2 cut(s) 174, 294
BseAI TCCGGA 1 cut(s) 227
BseBI CCWGG 1 cut(s) 116
BseLI CCNNNNNNNGG 2 cut(s) 139, 140
BseNI ACTGG 2 cut(s) 174, 294
BshFI GGCC 4 cut(s) 25, 119, 132, 351
BsiHKAI GWGCWC 1 cut(s) 321
BsiSI CCGG 1 cut(s) 228
BslFI GGGAC 1 cut(s) 294
BslI CCNNNNNNNGG 2 cut(s) 139, 140
BsmFI GGGAC 1 cut(s) 294
BsnI GGCC 4 cut(s) 25, 119, 132, 351
Bsp119I TTCGAA 1 cut(s) 165
Bsp1286I GDGCHC 1 cut(s) 321
Bsp13I TCCGGA 1 cut(s) 227
Bsp143I GATC 3 cut(s) 48, 108, 213
BspANI GGCC 4 cut(s) 25, 119, 132, 351
BspEI TCCGGA 1 cut(s) 227
BspHI TCATGA 1 cut(s) 279
BspLI GGNNCC 2 cut(s) 174, 250
BspMAI CTGCAG 1 cut(s) 94
BspT104I TTCGAA 1 cut(s) 165
BsrI ACTGG 2 cut(s) 174, 294
BssMI GATC 3 cut(s) 48, 108, 213
Bst2UI CCWGG 1 cut(s) 116
Bst6I CTCTTC 1 cut(s) 183
BstAPI GCANNNNNTGC 1 cut(s) 89
BstBI TTCGAA 1 cut(s) 165
BstDEI CTNAG 1 cut(s) 274
BstKTI GATC 3 cut(s) 51, 111, 216
BstMBI GATC 3 cut(s) 48, 108, 213
BstMWI GCNNNNNNNGC 2 cut(s) 41, 89
BstNI CCWGG 1 cut(s) 116
BstSCI CCNGG 1 cut(s) 114
BstSFI CTRYAG 1 cut(s) 90
BsuRI GGCC 4 cut(s) 25, 119, 132, 351
CciI TCATGA 1 cut(s) 279
Cfr13I GGNCC 3 cut(s) 131, 172, 349
CspCI CAANNNNNGTGG 2 cut(s) 109, 144
CviAII CATG 2 cut(s) 280, 300
CviJI RGCY 9 cut(s) 20, 25, 35, 57, 119, 132, 144, 319, 351
CviKI_1 RGCY 9 cut(s) 20, 25, 35, 57, 119, 132, 144, 319, 351
DdeI CTNAG 1 cut(s) 274
DpnI GATC 3 cut(s) 50, 110, 215
DpnII GATC 3 cut(s) 48, 108, 213
Eam1104I CTCTTC 1 cut(s) 183
EarI CTCTTC 1 cut(s) 183
Ecl136II GAGCTC 1 cut(s) 319
Eco24I GRGCYC 1 cut(s) 321
Eco47I GGWCC 1 cut(s) 172
Eco53kI GAGCTC 1 cut(s) 319
EcoICRI GAGCTC 1 cut(s) 319
EcoRI GAATTC 1 cut(s) 157
EcoRII CCWGG 1 cut(s) 114
EcoT22I ATGCAT 1 cut(s) 85
EcoT38I GRGCYC 1 cut(s) 321
FaeI CATG 2 cut(s) 283, 303
FaiI YATR 6 cut(s) 47, 218, 281, 301, 314, 341
FaqI GGGAC 1 cut(s) 294
FatI CATG 2 cut(s) 279, 299
FbaI TGATCA 2 cut(s) 48, 213
FriOI GRGCYC 1 cut(s) 321
HaeIII GGCC 4 cut(s) 25, 119, 132, 351
HapII CCGG 1 cut(s) 228
Hin1II CATG 2 cut(s) 283, 303
HpaII CCGG 1 cut(s) 228
Hpy166II GTNNAC 1 cut(s) 40
Hpy188I TCNGA 1 cut(s) 156
Hpy188III TCNNGA 4 cut(s) 228, 280, 355, 369
Hpy8I GTNNAC 1 cut(s) 40
HpyAV CCTTC 1 cut(s) 225
HpyCH4V TGCA 2 cut(s) 83, 92
HpyF10VI GCNNNNNNNGC 2 cut(s) 41, 89
HpyF3I CTNAG 1 cut(s) 274
Hsp92II CATG 2 cut(s) 283, 303
Kpn2I TCCGGA 1 cut(s) 227
Ksp22I TGATCA 2 cut(s) 48, 213
Kzo9I GATC 3 cut(s) 48, 108, 213
LpnPI CCDG 6 cut(s) 101, 128, 155, 241, 270, 307
LweI GCATC 2 cut(s) 51, 70
MalI GATC 3 cut(s) 50, 110, 215
MboI GATC 3 cut(s) 48, 108, 213
MboII GAAGA 2 cut(s) 170, 173
MhlI GDGCHC 1 cut(s) 321
MluCI AATT 4 cut(s) 6, 150, 157, 327
MnlI CCTC 2 cut(s) 186, 362
Mph1103I ATGCAT 1 cut(s) 85
MroI TCCGGA 1 cut(s) 227
MroXI GAANNNNTTC 1 cut(s) 161
MseI TTAA 1 cut(s) 66
MslI CAYNNNNRTG 1 cut(s) 75
MspI CCGG 1 cut(s) 228
MspR9I CCNGG 1 cut(s) 116
MvaI CCWGG 1 cut(s) 116
MwoI GCNNNNNNNGC 2 cut(s) 41, 89
NdeII GATC 3 cut(s) 48, 108, 213
NlaIII CATG 2 cut(s) 283, 303
NlaIV GGNNCC 2 cut(s) 174, 250
NsiI ATGCAT 1 cut(s) 85
NspV TTCGAA 1 cut(s) 165
PagI TCATGA 1 cut(s) 279
PdmI GAANNNNTTC 1 cut(s) 161
Psp124BI GAGCTC 1 cut(s) 321
Psp6I CCWGG 1 cut(s) 114
PspGI CCWGG 1 cut(s) 114
PspN4I GGNNCC 2 cut(s) 174, 250
PspPI GGNCC 3 cut(s) 131, 172, 349
PstI CTGCAG 1 cut(s) 94
RseI CAYNNNNRTG 1 cut(s) 75
SacI GAGCTC 1 cut(s) 321
SaqAI TTAA 1 cut(s) 66
Sau3AI GATC 3 cut(s) 48, 108, 213
Sau96I GGNCC 3 cut(s) 131, 172, 349
ScrFI CCNGG 1 cut(s) 116
SduI GDGCHC 1 cut(s) 321
SetI ASST 4 cut(s) 22, 37, 59, 321
SfaNI GCATC 2 cut(s) 51, 70
SfcI CTRYAG 1 cut(s) 90
SfuI TTCGAA 1 cut(s) 165
SinI GGWCC 1 cut(s) 172
SmiMI CAYNNNNRTG 1 cut(s) 75
SmlI CTYRAG 1 cut(s) 353
SmoI CTYRAG 1 cut(s) 353
Sse9I AATT 4 cut(s) 6, 150, 157, 327
SstI GAGCTC 1 cut(s) 321
StyD4I CCNGG 1 cut(s) 114
TaqI TCGA 2 cut(s) 111, 165
TasI AATT 4 cut(s) 6, 150, 157, 327
Tru1I TTAA 1 cut(s) 66
Tru9I TTAA 1 cut(s) 66
VpaK11BI GGWCC 1 cut(s) 172
XapI RAATTY 2 cut(s) 6, 157
XmnI GAANNNNTTC 1 cut(s) 161
Zsp2I ATGCAT 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.