Rh6AG478700

receptor protein kinase ZmPK1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
66033692 .. 66034087
396 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG478700.1

Sequence Viewer

Length: 396 bp
ATGGCCAACCGTGACCAACCGGTCAACGGTCACCACTCCAAGCTCTCCCTCCCGAGAAACGGCAACCTTATTCTCACCGATGCTGGCAAATCCATCTTTTGGTCCTCCAACACCGTCTCAAATTCATTAGTCCAATTGCTCCTCCACGACACTGGCAATCTTGTCCTGCTCGCCAGTGACAGTGTCGTTTTATGGGAAAGCTTTGCTTCACCAACGAACACTCTTTTGCCTTATCAGCCACTAACAAGGAACACCAAGAGCTCGTATCTTCTAGAAGCCTCACCAACTCCTCCTCCGGCCTCTACAAGCTCTTTTTCGATAATGACAACACCCTCCAGCTTCTCTACAATGGACCCGAAGTTTCGAGTATTTACTAGCCTGACCCTTGGCTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

131

Amino Acids

14.23

Weight (kDa)

8.16

Isoelectric Point (pI)

34.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B_lectin PF01453 1 - 87 6.8e-20 D-mannose binding lectin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030344)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0308691
rosa_samantha Rh6AG478700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 20
AccB7I CCANNNNNTGG 1 cut(s) 99
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 121
AfiI CCNNNNNNNGG 3 cut(s) 26, 59, 99
AgeI ACCGGT 1 cut(s) 19
AluBI AGCT 5 cut(s) 43, 201, 261, 309, 339
AluI AGCT 5 cut(s) 43, 201, 261, 309, 339
Alw21I GWGCWC 1 cut(s) 263
Alw26I GTCTC 1 cut(s) 121
Ama87I CYCGRG 1 cut(s) 52
AoxI GGCC 2 cut(s) 3, 297
ApoI RAATTY 1 cut(s) 121
AsiGI ACCGGT 1 cut(s) 19
AspS9I GGNCC 2 cut(s) 102, 352
AsuHPI GGTGA 4 cut(s) 23, 67, 201, 273
AvaI CYCGRG 1 cut(s) 52
AvaII GGWCC 2 cut(s) 102, 352
BalI TGGCCA 1 cut(s) 5
BanII GRGCYC 1 cut(s) 263
Bbv12I GWGCWC 1 cut(s) 263
BccI CCATC 1 cut(s) 101
BceAI ACGGC 1 cut(s) 76
BcoDI GTCTC 1 cut(s) 121
BfaI CTAG 2 cut(s) 272, 375
Bme18I GGWCC 2 cut(s) 102, 352
BmeT110I CYCGRG 1 cut(s) 52
BmgT120I GGNCC 2 cut(s) 102, 352
BmiI GGNNCC 1 cut(s) 354
BmsI GCATC 1 cut(s) 70
BpmI CTGGAG 1 cut(s) 319
BsaJI CCNNGG 1 cut(s) 385
BsaWI WCCGGW 1 cut(s) 19
BsaXI ACNNNNNCTCC 2 cut(s) 277, 307
Bsc4I CCNNNNNNNGG 3 cut(s) 26, 59, 99
Bse118I RCCGGY 1 cut(s) 19
Bse1I ACTGG 2 cut(s) 157, 174
BseDI CCNNGG 1 cut(s) 385
BseLI CCNNNNNNNGG 3 cut(s) 26, 59, 99
BseNI ACTGG 2 cut(s) 157, 174
BseRI GAGGAG 3 cut(s) 131, 279, 282
BshFI GGCC 2 cut(s) 5, 299
BshTI ACCGGT 1 cut(s) 19
BsiHKAI GWGCWC 1 cut(s) 263
BsiHKCI CYCGRG 1 cut(s) 52
BsiSI CCGG 2 cut(s) 20, 296
BslI CCNNNNNNNGG 3 cut(s) 26, 59, 99
BsmAI GTCTC 1 cut(s) 121
BsmBI CGTCTC 1 cut(s) 121
BsnI GGCC 2 cut(s) 5, 299
BsoBI CYCGRG 1 cut(s) 52
Bsp1286I GDGCHC 1 cut(s) 263
BspANI GGCC 2 cut(s) 5, 299
BspLI GGNNCC 1 cut(s) 354
BsrFI RCCGGY 1 cut(s) 19
BsrI ACTGG 2 cut(s) 157, 174
BssAI RCCGGY 1 cut(s) 19
BssECI CCNNGG 1 cut(s) 385
BssT1I CCWWGG 1 cut(s) 385
Bst4CI ACNGT 4 cut(s) 11, 29, 115, 182
BstC8I GCNNGC 2 cut(s) 85, 171
BstEII GGTNACC 1 cut(s) 29
BstMAI GTCTC 1 cut(s) 121
BstMWI GCNNNNNNNGC 1 cut(s) 235
BstPI GGTNACC 1 cut(s) 29
BstXI CCANNNNNNTGG 1 cut(s) 152
BsuRI GGCC 2 cut(s) 5, 299
BtsIMutI CAGTG 3 cut(s) 150, 181, 187
Cac8I GCNNGC 2 cut(s) 85, 171
Cfr10I RCCGGY 1 cut(s) 19
Cfr13I GGNCC 2 cut(s) 102, 352
CspAI ACCGGT 1 cut(s) 19
DrdI GACNNNNNNGTC 1 cut(s) 20
DseDI GACNNNNNNGTC 1 cut(s) 20
EaeI YGGCCR 1 cut(s) 3
Ecl136II GAGCTC 1 cut(s) 261
Eco130I CCWWGG 1 cut(s) 385
Eco24I GRGCYC 1 cut(s) 263
Eco47I GGWCC 2 cut(s) 102, 352
Eco53kI GAGCTC 1 cut(s) 261
Eco88I CYCGRG 1 cut(s) 52
Eco91I GGTNACC 1 cut(s) 29
EcoICRI GAGCTC 1 cut(s) 261
EcoO65I GGTNACC 1 cut(s) 29
EcoT14I CCWWGG 1 cut(s) 385
EcoT38I GRGCYC 1 cut(s) 263
ErhI CCWWGG 1 cut(s) 385
Esp3I CGTCTC 1 cut(s) 121
FaiI YATR 1 cut(s) 193
FalI AAGNNNNNCTT 2 cut(s) 190, 222
FriOI GRGCYC 1 cut(s) 263
FspBI CTAG 2 cut(s) 272, 375
GsuI CTGGAG 1 cut(s) 319
HaeIII GGCC 2 cut(s) 5, 299
HapII CCGG 2 cut(s) 20, 296
HincII GTYRAC 1 cut(s) 25
HindII GTYRAC 1 cut(s) 25
HindIII AAGCTT 1 cut(s) 199
HpaII CCGG 2 cut(s) 20, 296
HphI GGTGA 4 cut(s) 23, 67, 201, 273
Hpy166II GTNNAC 1 cut(s) 25
Hpy188III TCNNGA 2 cut(s) 52, 272
Hpy8I GTNNAC 1 cut(s) 25
HpyCH4III ACNGT 4 cut(s) 11, 29, 115, 182
HpyF10VI GCNNNNNNNGC 1 cut(s) 235
LmnI GCTCC 1 cut(s) 144
LpnPI CCDG 8 cut(s) 33, 69, 138, 179, 187, 309, 349, 392
LweI GCATC 1 cut(s) 70
MaeI CTAG 2 cut(s) 272, 375
MaeIII GTNAC 3 cut(s) 11, 29, 176
MboII GAAGA 1 cut(s) 260
MfeI CAATTG 1 cut(s) 134
MhlI GDGCHC 1 cut(s) 263
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 121, 134
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 132
MnlI CCTC 8 cut(s) 59, 115, 152, 289, 300, 303, 310, 343
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 2 cut(s) 20, 296
MunI CAATTG 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 235
NlaIV GGNNCC 1 cut(s) 354
NmuCI GTSAC 3 cut(s) 11, 29, 176
PflFI GACNNNGTC 1 cut(s) 182
PflMI CCANNNNNTGG 1 cut(s) 99
PinAI ACCGGT 1 cut(s) 19
Psp124BI GAGCTC 1 cut(s) 263
PspEI GGTNACC 1 cut(s) 29
PspN4I GGNNCC 1 cut(s) 354
PspPI GGNCC 2 cut(s) 102, 352
PsyI GACNNNGTC 1 cut(s) 182
SacI GAGCTC 1 cut(s) 263
Sau96I GGNCC 2 cut(s) 102, 352
SduI GDGCHC 1 cut(s) 263
SetI ASST 6 cut(s) 45, 69, 203, 263, 311, 341
SfaNI GCATC 1 cut(s) 70
SinI GGWCC 2 cut(s) 102, 352
Sse9I AATT 2 cut(s) 121, 134
SspMI CTAG 2 cut(s) 272, 375
SstI GAGCTC 1 cut(s) 263
StyI CCWWGG 1 cut(s) 385
TaaI ACNGT 4 cut(s) 11, 29, 115, 182
TaqI TCGA 2 cut(s) 317, 364
TasI AATT 2 cut(s) 121, 134
TscAI CASTG 3 cut(s) 157, 181, 187
TseFI GTSAC 3 cut(s) 11, 29, 176
Tsp45I GTSAC 3 cut(s) 11, 29, 176
TspDTI ATGAA 1 cut(s) 114
TspRI CASTG 3 cut(s) 157, 181, 187
Tth111I GACNNNGTC 1 cut(s) 182
Van91I CCANNNNNTGG 1 cut(s) 99
VpaK11BI GGWCC 2 cut(s) 102, 352
XapI RAATTY 1 cut(s) 121
XbaI TCTAGA 1 cut(s) 271
XspI CTAG 2 cut(s) 272, 375
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.