Rh6BG022700
HSP70 Family

Heat shock cognate 70 kDa

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0030426
Physical Location & Seq
Forward (+)
3380395 .. 3380934
540 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG022700.1

Sequence Viewer

Length: 183 bp
ATGGCTGATGCAAAGCGATTGATTGGCAGGAAATTTAGTGATGCATGTGTTAAGAGTGATATGAAATTATGGCCTTTCAAGATTCGTGGTGTGGGTGACAAGCCTATGATTATGATCAACTACAAGAATGAAAAGAAACAATTTGCCGCTGAGGAGATATCTTCAATTAATGGTTCTCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03040 ko04010 ko04141 ko04144 ko04213 ko04612 ko04915 ko05134 ko05145 ko05162 ko05164 ko05169 map03040 map04010 map04141 map04144 map04213 map04612 map04915 map05134 map05145 map05162 map05164 map05169
Pfam Domains
Protein Families
HSP70

Protein Analysis

60

Amino Acids

6.79

Weight (kDa)

9.67

Isoelectric Point (pI)

35.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HSP70 PF00012 2 - 55 5.7e-09 Hsp70 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030426)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0208971
rosa_samantha Rh6BG022700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 147
AcsI RAATTY 1 cut(s) 32
AgsI TTSAA 2 cut(s) 79, 165
AoxI GGCC 1 cut(s) 71
ApoI RAATTY 1 cut(s) 32
AseI ATTAAT 1 cut(s) 168
AsuHPI GGTGA 1 cut(s) 107
BbvCI CCTCAGC 1 cut(s) 150
BclI TGATCA 1 cut(s) 114
BisI GCNGC 1 cut(s) 147
BlsI GCNGC 1 cut(s) 148
BmsI GCATC 1 cut(s) 31
Bpu10I CCTNAGC 1 cut(s) 150
BsaBI GATNNNNATC 1 cut(s) 113
Bse8I GATNNNNATC 1 cut(s) 113
BseJI GATNNNNATC 1 cut(s) 113
BseMII CTCAG 1 cut(s) 141
BseRI GAGGAG 1 cut(s) 167
BshFI GGCC 1 cut(s) 73
BsnI GGCC 1 cut(s) 73
Bsp143I GATC 1 cut(s) 114
BspACI CCGC 1 cut(s) 147
BspANI GGCC 1 cut(s) 73
BspCNI CTCAG 1 cut(s) 142
BssMI GATC 1 cut(s) 114
BstDEI CTNAG 1 cut(s) 150
BstKTI GATC 1 cut(s) 117
BstMBI GATC 1 cut(s) 114
BstNSI RCATGY 1 cut(s) 48
BsuRI GGCC 1 cut(s) 73
CspCI CAANNNNNGTGG 2 cut(s) 67, 102
CviAII CATG 1 cut(s) 45
CviJI RGCY 3 cut(s) 5, 73, 103
CviKI_1 RGCY 3 cut(s) 5, 73, 103
DdeI CTNAG 1 cut(s) 150
DpnI GATC 1 cut(s) 116
DpnII GATC 1 cut(s) 114
Eco32I GATATC 1 cut(s) 159
EcoRV GATATC 1 cut(s) 159
EcoT22I ATGCAT 1 cut(s) 46
FaeI CATG 1 cut(s) 48
FaiI YATR 6 cut(s) 46, 62, 70, 107, 113, 181
FatI CATG 1 cut(s) 44
FbaI TGATCA 1 cut(s) 114
Fnu4HI GCNGC 1 cut(s) 147
Fsp4HI GCNGC 1 cut(s) 147
GluI GCNGC 1 cut(s) 147
HaeIII GGCC 1 cut(s) 73
Hin1II CATG 1 cut(s) 48
HinfI GANTC 1 cut(s) 82
HphI GGTGA 1 cut(s) 107
Hpy188III TCNNGA 1 cut(s) 79
HpyCH4V TGCA 2 cut(s) 11, 44
HpyF3I CTNAG 1 cut(s) 150
Hsp92II CATG 1 cut(s) 48
Ksp22I TGATCA 1 cut(s) 114
Kzo9I GATC 1 cut(s) 114
LpnPI CCDG 1 cut(s) 13
LweI GCATC 1 cut(s) 31
MaeIII GTNAC 1 cut(s) 95
MalI GATC 1 cut(s) 116
MboI GATC 1 cut(s) 114
MboII GAAGA 1 cut(s) 153
MluCI AATT 4 cut(s) 32, 65, 140, 165
MnlI CCTC 1 cut(s) 145
Mph1103I ATGCAT 1 cut(s) 46
MseI TTAA 2 cut(s) 51, 168
MspA1I CMGCKG 1 cut(s) 149
NdeII GATC 1 cut(s) 114
NlaIII CATG 1 cut(s) 48
NmuCI GTSAC 1 cut(s) 95
NsiI ATGCAT 1 cut(s) 46
NspI RCATGY 1 cut(s) 48
PfeI GAWTC 1 cut(s) 82
PkrI GCNGC 1 cut(s) 148
PshBI ATTAAT 1 cut(s) 168
SaqAI TTAA 2 cut(s) 51, 168
SatI GCNGC 1 cut(s) 147
Sau3AI GATC 1 cut(s) 114
SfaNI GCATC 1 cut(s) 31
SgeI CNNG 6 cut(s) 40, 57, 91, 98, 112, 136
Sse9I AATT 4 cut(s) 32, 65, 140, 165
SsiI CCGC 1 cut(s) 147
TasI AATT 4 cut(s) 32, 65, 140, 165
TauI GCSGC 1 cut(s) 149
TfiI GAWTC 1 cut(s) 82
Tru1I TTAA 2 cut(s) 51, 168
Tru9I TTAA 2 cut(s) 51, 168
TseFI GTSAC 1 cut(s) 95
Tsp45I GTSAC 1 cut(s) 95
TspDTI ATGAA 2 cut(s) 77, 144
VspI ATTAAT 1 cut(s) 168
XapI RAATTY 1 cut(s) 32
XceI RCATGY 1 cut(s) 48
Zsp2I ATGCAT 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.