Rh6CG210800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
34960220 .. 34960468
249 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG210800.1

Sequence Viewer

Length: 249 bp
ATGATCAATGAACATAATGCTGATGACAATGTTGGCAATATTGAAGACTTAGAATATGTGGAATTCTCCTCTGAAGATGATGACAATGTTGGCAATATTGAAGACTTAGAATTTGTGGAGTTCTCCTCTGAAGATGATGACAATGTTGGCAATATTGAAGACTTAGAATATGAGGACTTCTCCTCTAAAGATGATGAAGAACATCATTTGGAACCTCCTGCAAATCCTCGAAAGAGGAAGACGAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.53

Weight (kDa)

4.05

Isoelectric Point (pI)

73.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0033370)

Species Orthologous Gene IDs
rosa_samantha Rh6CG210800 Rh6DG201000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 62, 110
AcuI CTGAAG 2 cut(s) 93, 150
AgsI TTSAA 3 cut(s) 44, 101, 158
ApoI RAATTY 2 cut(s) 62, 110
ArsI GACNNNNNNTTYG 2 cut(s) 95, 127
BbsI GAAGAC 4 cut(s) 51, 108, 165, 245
BclI TGATCA 1 cut(s) 3
BmiI GGNNCC 1 cut(s) 213
BpiI GAAGAC 4 cut(s) 51, 108, 165, 245
BplI GAGNNNNNCTC 4 cut(s) 110, 142, 164, 196
BseRI GAGGAG 3 cut(s) 58, 115, 172
Bsp143I GATC 1 cut(s) 3
BspLI GGNNCC 1 cut(s) 213
BssMI GATC 1 cut(s) 3
BstDEI CTNAG 3 cut(s) 49, 106, 163
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstV2I GAAGAC 4 cut(s) 51, 108, 165, 245
DdeI CTNAG 3 cut(s) 49, 106, 163
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eco57I CTGAAG 2 cut(s) 93, 150
EcoRI GAATTC 1 cut(s) 62
FaiI YATR 3 cut(s) 15, 57, 171
FbaI TGATCA 1 cut(s) 3
Hpy188I TCNGA 2 cut(s) 73, 130
HpyCH4V TGCA 1 cut(s) 221
HpyF3I CTNAG 3 cut(s) 49, 106, 163
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 1 cut(s) 231
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 6 cut(s) 56, 86, 113, 143, 170, 209
MluCI AATT 2 cut(s) 62, 110
MnlI CCTC 7 cut(s) 79, 136, 166, 193, 225, 228, 237
NdeII GATC 1 cut(s) 3
NlaIV GGNNCC 1 cut(s) 213
PspN4I GGNNCC 1 cut(s) 213
Sau3AI GATC 1 cut(s) 3
SetI ASST 1 cut(s) 217
SgeI CNNG 2 cut(s) 230, 240
Sse9I AATT 2 cut(s) 62, 110
SspI AATATT 3 cut(s) 40, 97, 154
TaqI TCGA 1 cut(s) 229
TasI AATT 2 cut(s) 62, 110
TspDTI ATGAA 2 cut(s) 24, 210
XapI RAATTY 2 cut(s) 62, 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.