Rh7AG164400

L-type lectin-domain containing receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
14005532 .. 14006091
560 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG164400.1

Sequence Viewer

Length: 303 bp
ATGTATGTCGGGTTTTCCGGGTCGACCCAAGGAAGCACCGAAATCCACAGCGTTGAGTGGTGGAGCTTCAGCTCGTATTTCGATTCAACTCCCTTAATCGGGTCAGTAGCACCTCCTCCTCAGACGACTAATCTGATGAACCCAACCGCCAACTCGGTCAAATCTCCACCGCCTTCTTTAGCTCCAACTGGGTCCGTTTCAGCTTCTATTATTAGTACTACACAGAAGAACAGTAAGTCTTCTTCTTGCCATAACCAGCTTTGCAAGCAAGGTCCAGGAACTGTTGCTAAAAGCTTTTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

10.43

Weight (kDa)

8.71

Isoelectric Point (pI)

48.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025557)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0003263.1_g000001
rosa_samantha Rh7AG164400 Rh7CG172900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 23
AciI CCGC 2 cut(s) 147, 170
AcuI CTGAAG 1 cut(s) 52
AfaI GTAC 1 cut(s) 217
AfiI CCNNNNNNNGG 2 cut(s) 98, 99
AgsI TTSAA 1 cut(s) 87
AjnI CCWGG 1 cut(s) 274
AluBI AGCT 6 cut(s) 66, 72, 182, 203, 259, 294
AluI AGCT 6 cut(s) 66, 72, 182, 203, 259, 294
AlwNI CAGNNNCTG 1 cut(s) 281
AspS9I GGNCC 2 cut(s) 192, 272
AsuC2I CCSGG 1 cut(s) 19
AvaII GGWCC 2 cut(s) 192, 272
BarI GAAGNNNNNNTAC 2 cut(s) 226, 258
BbsI GAAGAC 1 cut(s) 231
BciT130I CCWGG 1 cut(s) 276
BcnI CCSGG 1 cut(s) 19
BmcAI AGTACT 1 cut(s) 217
Bme1390I CCNGG 2 cut(s) 19, 276
Bme18I GGWCC 2 cut(s) 192, 272
BmgT120I GGNCC 2 cut(s) 192, 272
BmiI GGNNCC 1 cut(s) 193
BmrFI CCNGG 2 cut(s) 19, 276
BmrI ACTGGG 1 cut(s) 198
BmuI ACTGGG 1 cut(s) 198
BpiI GAAGAC 1 cut(s) 231
BpuMI CCSGG 1 cut(s) 19
BsaJI CCNNGG 1 cut(s) 28
Bsc4I CCNNNNNNNGG 2 cut(s) 98, 99
Bse1I ACTGG 1 cut(s) 193
BseBI CCWGG 1 cut(s) 276
BseDI CCNNGG 1 cut(s) 28
BseLI CCNNNNNNNGG 2 cut(s) 98, 99
BseMII CTCAG 1 cut(s) 134
BseNI ACTGG 1 cut(s) 193
BseRI GAGGAG 2 cut(s) 105, 108
BsiSI CCGG 1 cut(s) 18
BslI CCNNNNNNNGG 2 cut(s) 98, 99
BspACI CCGC 2 cut(s) 147, 170
BspCNI CTCAG 1 cut(s) 133
BspLI GGNNCC 1 cut(s) 193
BsrI ACTGG 1 cut(s) 193
BssECI CCNNGG 1 cut(s) 28
BssT1I CCWWGG 1 cut(s) 28
Bst2UI CCWGG 1 cut(s) 276
Bst4CI ACNGT 2 cut(s) 233, 283
BstC8I GCNNGC 1 cut(s) 266
BstDEI CTNAG 1 cut(s) 120
BstMWI GCNNNNNNNGC 1 cut(s) 265
BstNI CCWGG 1 cut(s) 276
BstSCI CCNGG 2 cut(s) 17, 274
BstV2I GAAGAC 1 cut(s) 231
Cac8I GCNNGC 1 cut(s) 266
CaiI CAGNNNCTG 1 cut(s) 281
Cfr13I GGNCC 2 cut(s) 192, 272
Csp6I GTAC 1 cut(s) 216
CviJI RGCY 6 cut(s) 66, 72, 182, 203, 259, 294
CviKI_1 RGCY 6 cut(s) 66, 72, 182, 203, 259, 294
CviQI GTAC 1 cut(s) 216
DdeI CTNAG 1 cut(s) 120
Eco130I CCWWGG 1 cut(s) 28
Eco47I GGWCC 2 cut(s) 192, 272
Eco57I CTGAAG 1 cut(s) 52
EcoRII CCWGG 1 cut(s) 274
EcoT14I CCWWGG 1 cut(s) 28
ErhI CCWWGG 1 cut(s) 28
FaiI YATR 3 cut(s) 6, 252, 301
FblI GTMKAC 1 cut(s) 23
HapII CCGG 1 cut(s) 18
HincII GTYRAC 1 cut(s) 24
HindII GTYRAC 1 cut(s) 24
HindIII AAGCTT 1 cut(s) 292
HinfI GANTC 1 cut(s) 83
HpaII CCGG 1 cut(s) 18
Hpy166II GTNNAC 1 cut(s) 24
Hpy188I TCNGA 2 cut(s) 123, 135
Hpy8I GTNNAC 1 cut(s) 24
HpyAV CCTTC 1 cut(s) 183
HpyCH4III ACNGT 2 cut(s) 233, 283
HpyCH4V TGCA 1 cut(s) 264
HpyF10VI GCNNNNNNNGC 1 cut(s) 265
HpyF3I CTNAG 1 cut(s) 120
LmnI GCTCC 2 cut(s) 63, 187
LpnPI CCDG 5 cut(s) 31, 174, 261, 269, 288
MboII GAAGA 3 cut(s) 231, 234, 238
MmeI TCCRAC 1 cut(s) 209
MnlI CCTC 3 cut(s) 123, 126, 129
MseI TTAA 1 cut(s) 95
MspI CCGG 1 cut(s) 18
MspR9I CCNGG 2 cut(s) 19, 276
MvaI CCWGG 1 cut(s) 276
MwoI GCNNNNNNNGC 1 cut(s) 265
NciI CCSGG 1 cut(s) 19
NlaIV GGNNCC 1 cut(s) 193
PfeI GAWTC 1 cut(s) 83
PfoI TCCNGGA 1 cut(s) 274
Psp6I CCWGG 1 cut(s) 274
PspGI CCWGG 1 cut(s) 274
PspN4I GGNNCC 1 cut(s) 193
PspPI GGNCC 2 cut(s) 192, 272
PstNI CAGNNNCTG 1 cut(s) 281
RsaI GTAC 1 cut(s) 217
RsaNI GTAC 1 cut(s) 216
SalI GTCGAC 1 cut(s) 22
SaqAI TTAA 1 cut(s) 95
Sau96I GGNCC 2 cut(s) 192, 272
ScaI AGTACT 1 cut(s) 217
ScrFI CCNGG 2 cut(s) 19, 276
SetI ASST 8 cut(s) 68, 74, 115, 184, 205, 261, 274, 296
SinI GGWCC 2 cut(s) 192, 272
SsiI CCGC 2 cut(s) 147, 170
StyD4I CCNGG 2 cut(s) 17, 274
StyI CCWWGG 1 cut(s) 28
TaaI ACNGT 2 cut(s) 233, 283
TaqI TCGA 2 cut(s) 23, 81
TaqII GACCGA 1 cut(s) 145
TatI WGTACW 1 cut(s) 215
TfiI GAWTC 1 cut(s) 83
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
TspDTI ATGAA 2 cut(s) 152, 288
TspGWI ACGGA 1 cut(s) 184
VpaK11BI GGWCC 2 cut(s) 192, 272
XmiI GTMKAC 1 cut(s) 23
ZrmI AGTACT 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.