Rh7CG172900

L-type lectin-domain containing receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
14648943 .. 14649916
974 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG172900.1

Sequence Viewer

Length: 258 bp
ATGTATGTCAGGTTTTCCGGGTCCATCCAAGGAAGCATCGAAATCCACAGCGTTGAGTGGTGGAGCTTCAGCTCGTCTTACGATTCAACTCCCTTAATCGGGTCAGTAGCACCTCTTCCTCAGACGACTAATCTGATGAACCCAACCGCCAACTCGGTCAAATTTCCACCACCTTCTTTGGCTCCAACTGGGTCTGATTCATCTTCTATTACTAGTACTACACATAAGAACAAGAAAGTGAGCGAGAGGCATCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.23

Weight (kDa)

8.17

Isoelectric Point (pI)

59.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025557)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0003263.1_g000001
rosa_samantha Rh7AG164400 Rh7CG172900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 147
AcsI RAATTY 1 cut(s) 161
AcuI CTGAAG 1 cut(s) 52
AfaI GTAC 1 cut(s) 217
AfiI CCNNNNNNNGG 2 cut(s) 98, 99
AgsI TTSAA 1 cut(s) 87
AhlI ACTAGT 1 cut(s) 212
AluBI AGCT 2 cut(s) 66, 72
AluI AGCT 2 cut(s) 66, 72
ApoI RAATTY 1 cut(s) 161
AspS9I GGNCC 1 cut(s) 21
AsuC2I CCSGG 1 cut(s) 19
AvaII GGWCC 1 cut(s) 21
BarI GAAGNNNNNNTAC 2 cut(s) 99, 131
BccI CCATC 1 cut(s) 32
BcnI CCSGG 1 cut(s) 19
BcuI ACTAGT 1 cut(s) 212
BfaI CTAG 1 cut(s) 213
BmcAI AGTACT 1 cut(s) 217
Bme1390I CCNGG 1 cut(s) 19
Bme18I GGWCC 1 cut(s) 21
BmgT120I GGNCC 1 cut(s) 21
BmiI GGNNCC 2 cut(s) 22, 183
BmrFI CCNGG 1 cut(s) 19
BmrI ACTGGG 1 cut(s) 198
BmsI GCATC 1 cut(s) 45
BmuI ACTGGG 1 cut(s) 198
BpuMI CCSGG 1 cut(s) 19
BsaJI CCNNGG 1 cut(s) 28
Bsc4I CCNNNNNNNGG 2 cut(s) 98, 99
Bse1I ACTGG 1 cut(s) 193
BseDI CCNNGG 1 cut(s) 28
BseGI GGATG 1 cut(s) 24
BseLI CCNNNNNNNGG 2 cut(s) 98, 99
BseMII CTCAG 1 cut(s) 134
BseNI ACTGG 1 cut(s) 193
BsiSI CCGG 1 cut(s) 18
BslI CCNNNNNNNGG 2 cut(s) 98, 99
BspACI CCGC 1 cut(s) 147
BspCNI CTCAG 1 cut(s) 133
BspLI GGNNCC 2 cut(s) 22, 183
BsrI ACTGG 1 cut(s) 193
BssECI CCNNGG 1 cut(s) 28
BssT1I CCWWGG 1 cut(s) 28
Bst6I CTCTTC 1 cut(s) 120
BstDEI CTNAG 1 cut(s) 120
BstF5I GGATG 1 cut(s) 24
BstSCI CCNGG 1 cut(s) 17
BtsCI GGATG 1 cut(s) 24
Cfr13I GGNCC 1 cut(s) 21
Csp6I GTAC 1 cut(s) 216
CspCI CAANNNNNGTGG 2 cut(s) 159, 194
CviJI RGCY 3 cut(s) 66, 72, 182
CviKI_1 RGCY 3 cut(s) 66, 72, 182
CviQI GTAC 1 cut(s) 216
DdeI CTNAG 1 cut(s) 120
Eam1104I CTCTTC 1 cut(s) 120
EarI CTCTTC 1 cut(s) 120
Eco130I CCWWGG 1 cut(s) 28
Eco47I GGWCC 1 cut(s) 21
Eco57I CTGAAG 1 cut(s) 52
EcoT14I CCWWGG 1 cut(s) 28
ErhI CCWWGG 1 cut(s) 28
FaiI YATR 2 cut(s) 6, 225
FokI GGATG 1 cut(s) 11
FspBI CTAG 1 cut(s) 213
HapII CCGG 1 cut(s) 18
HinfI GANTC 2 cut(s) 83, 197
HpaII CCGG 1 cut(s) 18
Hpy188I TCNGA 3 cut(s) 123, 135, 196
HpyAV CCTTC 1 cut(s) 183
HpyF3I CTNAG 1 cut(s) 120
LmnI GCTCC 2 cut(s) 63, 187
LpnPI CCDG 2 cut(s) 31, 174
LweI GCATC 1 cut(s) 45
MaeI CTAG 1 cut(s) 213
MboII GAAGA 2 cut(s) 107, 195
MluCI AATT 1 cut(s) 161
MmeI TCCRAC 1 cut(s) 209
MnlI CCTC 3 cut(s) 123, 129, 240
MseI TTAA 1 cut(s) 95
MspI CCGG 1 cut(s) 18
MspR9I CCNGG 1 cut(s) 19
NciI CCSGG 1 cut(s) 19
NlaIV GGNNCC 2 cut(s) 22, 183
PfeI GAWTC 2 cut(s) 83, 197
PspN4I GGNNCC 2 cut(s) 22, 183
PspPI GGNCC 1 cut(s) 21
RsaI GTAC 1 cut(s) 217
RsaNI GTAC 1 cut(s) 216
SaqAI TTAA 1 cut(s) 95
Sau96I GGNCC 1 cut(s) 21
ScaI AGTACT 1 cut(s) 217
ScrFI CCNGG 1 cut(s) 19
SetI ASST 5 cut(s) 14, 68, 74, 115, 175
SfaNI GCATC 1 cut(s) 45
SinI GGWCC 1 cut(s) 21
SpeI ACTAGT 1 cut(s) 212
Sse9I AATT 1 cut(s) 161
SsiI CCGC 1 cut(s) 147
SspMI CTAG 1 cut(s) 213
StyD4I CCNGG 1 cut(s) 17
StyI CCWWGG 1 cut(s) 28
TaqI TCGA 1 cut(s) 39
TaqII GACCGA 1 cut(s) 145
TasI AATT 1 cut(s) 161
TatI WGTACW 1 cut(s) 215
TfiI GAWTC 2 cut(s) 83, 197
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
TspDTI ATGAA 2 cut(s) 152, 189
VpaK11BI GGWCC 1 cut(s) 21
XapI RAATTY 1 cut(s) 161
XspI CTAG 1 cut(s) 213
ZrmI AGTACT 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.