Rh7AG496100

mediator of RNA polymerase II transcription subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
69642635 .. 69643330
696 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG496100.1

Sequence Viewer

Length: 165 bp
ATGCAAATAGTCAGGCTCATATCTCAGGATCACATGAATAACAAGCAATATGTGGGAAGGGCAGACTTTCTAGTATTTCGGGCAATGAATCAGCATGGATTTCTTGGGCAGTTGCAAGAAAAGAAGCTTGTAAGCTCTCTCTCTGTGATAGTTCCTTTCTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.3

Weight (kDa)

9.82

Isoelectric Point (pI)

36.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025009)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0075601 RchiOBHm_Chr7g0240991
rosa_samantha Rh7AG496100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 36
AluBI AGCT 2 cut(s) 127, 135
AluI AGCT 2 cut(s) 127, 135
AlwI GGATC 1 cut(s) 36
BfaI CTAG 1 cut(s) 71
Bse3DI GCAATG 1 cut(s) 90
BseMI GCAATG 1 cut(s) 90
BseMII CTCAG 1 cut(s) 38
Bsp143I GATC 1 cut(s) 28
BspCNI CTCAG 1 cut(s) 37
BspPI GGATC 1 cut(s) 36
BsrDI GCAATG 1 cut(s) 90
BssMI GATC 1 cut(s) 28
BstDEI CTNAG 1 cut(s) 24
BstKTI GATC 1 cut(s) 31
BstMBI GATC 1 cut(s) 28
CviAII CATG 2 cut(s) 34, 95
CviJI RGCY 3 cut(s) 16, 127, 135
CviKI_1 RGCY 3 cut(s) 16, 127, 135
DdeI CTNAG 1 cut(s) 24
DpnI GATC 1 cut(s) 30
DpnII GATC 1 cut(s) 28
FaeI CATG 2 cut(s) 37, 98
FaiI YATR 4 cut(s) 20, 35, 51, 96
FatI CATG 2 cut(s) 33, 94
FspBI CTAG 1 cut(s) 71
Hin1II CATG 2 cut(s) 37, 98
HindIII AAGCTT 1 cut(s) 125
HinfI GANTC 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 26
HpyAV CCTTC 1 cut(s) 51
HpyCH4V TGCA 2 cut(s) 4, 115
HpyF3I CTNAG 1 cut(s) 24
Hsp92II CATG 2 cut(s) 37, 98
Kzo9I GATC 1 cut(s) 28
LpnPI CCDG 1 cut(s) 11
MaeI CTAG 1 cut(s) 71
MalI GATC 1 cut(s) 30
MboI GATC 1 cut(s) 28
MseI TTAA 1 cut(s) 163
NdeII GATC 1 cut(s) 28
NlaIII CATG 2 cut(s) 37, 98
PfeI GAWTC 1 cut(s) 88
SaqAI TTAA 1 cut(s) 163
Sau3AI GATC 1 cut(s) 28
SetI ASST 2 cut(s) 129, 137
SspMI CTAG 1 cut(s) 71
TfiI GAWTC 1 cut(s) 88
Tru1I TTAA 1 cut(s) 163
Tru9I TTAA 1 cut(s) 163
TspDTI ATGAA 2 cut(s) 50, 101
XspI CTAG 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.