Rh7BG041800

Autophagy-related protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
2667065 .. 2669278
2214 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG041800.1

Sequence Viewer

Length: 216 bp
ATGCTATTTAGCTCTAGTCTTCTTGCCATTGTTGGAGCTGGTGAAGAGCCATCTTTATCTCCGCGTCGTCTCTGTTTGTTCAATACAACAATTGGAACTGCTCTTCGAGAATTGAACTTTTTGACTTCAATACTTTCCGTTCGTATGAATAGGAAAAGCTTTAAAGTCCCAAAGCTGTGCAGTACTTCTATTAGATTAAAGCTTCACATACTTTGA

Protein Analysis

71

Amino Acids

7.89

Weight (kDa)

10.92

Isoelectric Point (pI)

42.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024821)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0117061
rosa_rugosa Rorug02G0200200
rosa_samantha Rh7BG041800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 64
AciI CCGC 1 cut(s) 62
AfaI GTAC 1 cut(s) 184
AgsI TTSAA 3 cut(s) 82, 115, 129
AluBI AGCT 5 cut(s) 12, 38, 159, 175, 202
AluI AGCT 5 cut(s) 12, 38, 159, 175, 202
Alw26I GTCTC 1 cut(s) 74
AsuHPI GGTGA 1 cut(s) 53
BbsI GAAGAC 1 cut(s) 11
BccI CCATC 1 cut(s) 58
BcoDI GTCTC 1 cut(s) 74
BfaI CTAG 1 cut(s) 15
BmcAI AGTACT 1 cut(s) 184
BpiI GAAGAC 1 cut(s) 11
BsgI GTGCAG 1 cut(s) 199
Bsh1236I CGCG 1 cut(s) 64
BslFI GGGAC 1 cut(s) 152
BsmAI GTCTC 1 cut(s) 74
BsmBI CGTCTC 1 cut(s) 74
BsmFI GGGAC 1 cut(s) 152
BspACI CCGC 1 cut(s) 62
BspFNI CGCG 1 cut(s) 64
BspQI GCTCTTC 2 cut(s) 39, 108
Bst6I CTCTTC 2 cut(s) 39, 108
BstFNI CGCG 1 cut(s) 64
BstMAI GTCTC 1 cut(s) 74
BstUI CGCG 1 cut(s) 64
BstV2I GAAGAC 1 cut(s) 11
CseI GACGC 1 cut(s) 53
Csp6I GTAC 1 cut(s) 183
CviJI RGCY 6 cut(s) 12, 38, 49, 159, 175, 202
CviKI_1 RGCY 6 cut(s) 12, 38, 49, 159, 175, 202
CviQI GTAC 1 cut(s) 183
DraI TTTAAA 1 cut(s) 163
Eam1104I CTCTTC 2 cut(s) 39, 108
EarI CTCTTC 2 cut(s) 39, 108
Esp3I CGTCTC 1 cut(s) 74
FaiI YATR 2 cut(s) 146, 209
FaqI GGGAC 1 cut(s) 152
FspBI CTAG 1 cut(s) 15
HgaI GACGC 1 cut(s) 53
HindIII AAGCTT 2 cut(s) 157, 200
HphI GGTGA 1 cut(s) 53
Hpy188III TCNNGA 1 cut(s) 107
Hpy99I CGWCG 1 cut(s) 69
HpyCH4V TGCA 1 cut(s) 180
LguI GCTCTTC 2 cut(s) 39, 108
LmnI GCTCC 1 cut(s) 35
LpnPI CCDG 1 cut(s) 24
MaeI CTAG 1 cut(s) 15
MboII GAAGA 3 cut(s) 11, 56, 95
MfeI CAATTG 1 cut(s) 90
MluCI AATT 2 cut(s) 90, 110
MmeI TCCRAC 1 cut(s) 13
MseI TTAA 2 cut(s) 162, 197
MunI CAATTG 1 cut(s) 90
MvnI CGCG 1 cut(s) 64
PciSI GCTCTTC 2 cut(s) 39, 108
RsaI GTAC 1 cut(s) 184
RsaNI GTAC 1 cut(s) 183
SapI GCTCTTC 2 cut(s) 39, 108
SaqAI TTAA 2 cut(s) 162, 197
ScaI AGTACT 1 cut(s) 184
SetI ASST 5 cut(s) 14, 40, 161, 177, 204
SgeI CNNG 5 cut(s) 27, 35, 51, 75, 119
Sse9I AATT 2 cut(s) 90, 110
SsiI CCGC 1 cut(s) 62
SspMI CTAG 1 cut(s) 15
TaqI TCGA 1 cut(s) 106
TasI AATT 2 cut(s) 90, 110
TatI WGTACW 1 cut(s) 182
Tru1I TTAA 2 cut(s) 162, 197
Tru9I TTAA 2 cut(s) 162, 197
TspDTI ATGAA 1 cut(s) 161
TspGWI ACGGA 1 cut(s) 127
XspI CTAG 1 cut(s) 15
ZrmI AGTACT 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.