Rh7DG285100

Catalyzes conversion of folates to polyglutamate derivatives allowing concentration of folate compounds in the cell and the intracellular retention of these cofactors, which are important substrates for most of the folate-dependent enzymes that are involved in one-carbon transfer reactions involved in purine, pyrimidine and amino acid synthesis

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
31423836 .. 31427579
3744 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG285100.1

Sequence Viewer

Length: 312 bp
ATGATGTCATCTCAAGTTATGGAACAAATGCAAAGCAATGTGGTTGTCAAAGAGCACTCAGAGGACCTACCTCTTACATCGTCATATGAATCTTCCATGGAAGCACTTTCCTCTCTCATTATAAGTAAAAAACGTGGAGACGGATCATCTGTTGGTGGTAAATATGAAAAATTGGAGAGGATGACGATGTATCTCAAGATACTAGACTTGGAGAAAGACATAGGAGGACTCAGAATTATTCATGTAGCTGGAACCAAGGGACATGTGTTTCTTCTTACCATAAACTATATATGCTTGATAAATCAGACTTAG

Protein Analysis

103

Amino Acids

11.5

Weight (kDa)

6.27

Isoelectric Point (pI)

41.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022660)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0097681
rosa_rugosa Rorug05G0570700.1
rosa_samantha Rh2DG118700 Rh7DG285100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 122
AclWI GGATC 1 cut(s) 151
AflIII ACRYGT 1 cut(s) 262
AluBI AGCT 1 cut(s) 248
AluI AGCT 1 cut(s) 248
Alw21I GWGCWC 1 cut(s) 57
Alw26I GTCTC 1 cut(s) 132
AlwI GGATC 1 cut(s) 151
AspS9I GGNCC 1 cut(s) 64
AvaII GGWCC 1 cut(s) 64
Bbv12I GWGCWC 1 cut(s) 57
BcoDI GTCTC 1 cut(s) 132
BfaI CTAG 1 cut(s) 203
Bme18I GGWCC 1 cut(s) 64
BmgT120I GGNCC 1 cut(s) 64
BmiI GGNNCC 1 cut(s) 253
BpuEI CTTGAG 1 cut(s) 179
BsaJI CCNNGG 2 cut(s) 96, 255
Bse3DI GCAATG 1 cut(s) 43
BseDI CCNNGG 2 cut(s) 96, 255
BseGI GGATG 1 cut(s) 186
BseMI GCAATG 1 cut(s) 43
BseMII CTCAG 2 cut(s) 72, 244
BsiHKAI GWGCWC 1 cut(s) 57
BslFI GGGAC 1 cut(s) 273
BsmAI GTCTC 1 cut(s) 132
BsmBI CGTCTC 1 cut(s) 132
BsmFI GGGAC 1 cut(s) 273
Bsp1286I GDGCHC 1 cut(s) 57
Bsp143I GATC 1 cut(s) 143
Bsp19I CCATGG 1 cut(s) 96
BspCNI CTCAG 2 cut(s) 71, 243
BspLI GGNNCC 1 cut(s) 253
BspPI GGATC 1 cut(s) 151
BsrDI GCAATG 1 cut(s) 43
BssECI CCNNGG 2 cut(s) 96, 255
BssMI GATC 1 cut(s) 143
BssT1I CCWWGG 2 cut(s) 96, 255
BstDEI CTNAG 3 cut(s) 58, 230, 309
BstDSI CCRYGG 1 cut(s) 96
BstF5I GGATG 1 cut(s) 186
BstKTI GATC 1 cut(s) 146
BstMAI GTCTC 1 cut(s) 132
BstMBI GATC 1 cut(s) 143
BstNSI RCATGY 1 cut(s) 266
BtgI CCRYGG 1 cut(s) 96
BtsCI GGATG 1 cut(s) 186
Cfr13I GGNCC 1 cut(s) 64
CviAII CATG 3 cut(s) 97, 242, 263
CviJI RGCY 1 cut(s) 248
CviKI_1 RGCY 1 cut(s) 248
DdeI CTNAG 3 cut(s) 58, 230, 309
DpnI GATC 1 cut(s) 145
DpnII GATC 1 cut(s) 143
Eco130I CCWWGG 2 cut(s) 96, 255
Eco47I GGWCC 1 cut(s) 64
EcoO109I RGGNCCY 1 cut(s) 64
EcoT14I CCWWGG 2 cut(s) 96, 255
ErhI CCWWGG 2 cut(s) 96, 255
Esp3I CGTCTC 1 cut(s) 132
FaeI CATG 3 cut(s) 100, 245, 266
FaqI GGGAC 1 cut(s) 273
FatI CATG 3 cut(s) 96, 241, 262
FauNDI CATATG 1 cut(s) 85
FokI GGATG 1 cut(s) 193
FspBI CTAG 1 cut(s) 203
Hin1II CATG 3 cut(s) 100, 245, 266
HinfI GANTC 2 cut(s) 89, 228
Hpy188I TCNGA 3 cut(s) 61, 233, 306
Hpy188III TCNNGA 1 cut(s) 196
HpyCH4IV ACGT 1 cut(s) 133
HpyCH4V TGCA 1 cut(s) 31
HpyF3I CTNAG 3 cut(s) 58, 230, 309
HpySE526I ACGT 1 cut(s) 133
Hsp92II CATG 3 cut(s) 100, 245, 266
Kzo9I GATC 1 cut(s) 143
LpnPI CCDG 1 cut(s) 234
MaeI CTAG 1 cut(s) 203
MaeII ACGT 1 cut(s) 133
MalI GATC 1 cut(s) 145
MboI GATC 1 cut(s) 143
MboII GAAGA 2 cut(s) 84, 263
MhlI GDGCHC 1 cut(s) 57
MluCI AATT 2 cut(s) 170, 234
MlyI GAGTC 1 cut(s) 222
MnlI CCTC 5 cut(s) 55, 81, 121, 171, 218
NcoI CCATGG 1 cut(s) 96
NdeI CATATG 1 cut(s) 85
NdeII GATC 1 cut(s) 143
NlaIII CATG 3 cut(s) 100, 245, 266
NlaIV GGNNCC 1 cut(s) 253
NspI RCATGY 1 cut(s) 266
PciI ACATGT 1 cut(s) 262
PfeI GAWTC 1 cut(s) 89
PleI GAGTC 1 cut(s) 222
PpsI GAGTC 1 cut(s) 222
PpuMI RGGWCCY 1 cut(s) 64
PscI ACATGT 1 cut(s) 262
PsiI TTATAA 1 cut(s) 122
Psp5II RGGWCCY 1 cut(s) 64
PspN4I GGNNCC 1 cut(s) 253
PspPI GGNCC 1 cut(s) 64
PspPPI RGGWCCY 1 cut(s) 64
Sau3AI GATC 1 cut(s) 143
Sau96I GGNCC 1 cut(s) 64
SchI GAGTC 1 cut(s) 222
SduI GDGCHC 1 cut(s) 57
SetI ASST 4 cut(s) 69, 73, 136, 250
SinI GGWCC 1 cut(s) 64
SmlI CTYRAG 2 cut(s) 12, 194
SmoI CTYRAG 2 cut(s) 12, 194
Sse9I AATT 2 cut(s) 170, 234
SspMI CTAG 1 cut(s) 203
StyI CCWWGG 2 cut(s) 96, 255
TaiI ACGT 1 cut(s) 136
TasI AATT 2 cut(s) 170, 234
TfiI GAWTC 1 cut(s) 89
TspDTI ATGAA 3 cut(s) 102, 180, 230
TspGWI ACGGA 1 cut(s) 156
VpaK11BI GGWCC 1 cut(s) 64
XceI RCATGY 1 cut(s) 266
XspI CTAG 1 cut(s) 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.