Rw1G017990

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Forward (+)
39670483 .. 39670750
268 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G017990.1

Sequence Viewer

Length: 186 bp
ATGCCAGGGACGTACTTCCTCTCCGACGGACCACAGCAGCAAAGAAATAGACAATACTATGCTTGTCGGACAGATATCTGGAACAGAGTGATTGGAGAGTCTGATGATGAAGAAACAGCAGAGAGAGAAGTAGGTGAGCAGGGTGCGCCTGACGGGACACTTGCAGAAGCAGAAGCTGATGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.87

Weight (kDa)

4.08

Isoelectric Point (pI)

49.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021587)

Species Orthologous Gene IDs
rosa_laevigata RLG00000028659
rosa_roxburghii Rroxscaffold_4G00306990
rosa_samantha Rh1BG179100 Rh1DG208800
rosa_wichuraiana Rw1G017990

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 14
AjnI CCWGG 1 cut(s) 4
AluBI AGCT 1 cut(s) 176
AluI AGCT 1 cut(s) 176
AlwNI CAGNNNCTG 1 cut(s) 176
ApeKI GCWGC 1 cut(s) 37
AspLEI GCGC 1 cut(s) 148
AspS9I GGNCC 1 cut(s) 29
AsuHPI GGTGA 1 cut(s) 146
AvaII GGWCC 1 cut(s) 29
BbvI GCAGC 1 cut(s) 49
BciT130I CCWGG 1 cut(s) 6
BisI GCNGC 1 cut(s) 38
BlsI GCNGC 1 cut(s) 39
Bme1390I CCNGG 1 cut(s) 6
Bme18I GGWCC 1 cut(s) 29
BmgT120I GGNCC 1 cut(s) 29
BmrFI CCNGG 1 cut(s) 6
BsaJI CCNNGG 1 cut(s) 5
BsaXI ACNNNNNCTCC 2 cut(s) 5, 35
BseBI CCWGG 1 cut(s) 6
BseDI CCNNGG 1 cut(s) 5
BseXI GCAGC 1 cut(s) 49
BslFI GGGAC 2 cut(s) 22, 169
BsmFI GGGAC 2 cut(s) 22, 169
BssECI CCNNGG 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 6
BstHHI GCGC 1 cut(s) 148
BstMWI GCNNNNNNNGC 1 cut(s) 145
BstNI CCWGG 1 cut(s) 6
BstSCI CCNGG 1 cut(s) 4
BstV1I GCAGC 1 cut(s) 49
CaiI CAGNNNCTG 1 cut(s) 176
CfoI GCGC 1 cut(s) 148
Cfr13I GGNCC 1 cut(s) 29
Csp6I GTAC 1 cut(s) 13
CviJI RGCY 1 cut(s) 176
CviKI_1 RGCY 1 cut(s) 176
CviQI GTAC 1 cut(s) 13
Eco32I GATATC 1 cut(s) 76
Eco47I GGWCC 1 cut(s) 29
EcoRII CCWGG 1 cut(s) 4
EcoRV GATATC 1 cut(s) 76
FaiI YATR 1 cut(s) 60
FaqI GGGAC 2 cut(s) 22, 169
Fnu4HI GCNGC 1 cut(s) 38
Fsp4HI GCNGC 1 cut(s) 38
GlaI GCGC 1 cut(s) 147
GluI GCNGC 1 cut(s) 38
HhaI GCGC 1 cut(s) 148
Hin6I GCGC 1 cut(s) 146
HinP1I GCGC 1 cut(s) 146
HinfI GANTC 1 cut(s) 98
HphI GGTGA 1 cut(s) 146
Hpy188I TCNGA 3 cut(s) 25, 69, 103
Hpy188III TCNNGA 1 cut(s) 79
Hpy99I CGWCG 1 cut(s) 29
HpyCH4IV ACGT 1 cut(s) 11
HpyCH4V TGCA 1 cut(s) 164
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
HpySE526I ACGT 1 cut(s) 11
HspAI GCGC 1 cut(s) 146
LpnPI CCDG 4 cut(s) 18, 64, 125, 162
Lsp1109I GCAGC 1 cut(s) 49
MaeII ACGT 1 cut(s) 11
MboII GAAGA 1 cut(s) 122
MlyI GAGTC 1 cut(s) 107
MmeI TCCRAC 2 cut(s) 47, 48
MnlI CCTC 1 cut(s) 29
MspR9I CCNGG 1 cut(s) 6
MvaI CCWGG 1 cut(s) 6
MwoI GCNNNNNNNGC 1 cut(s) 145
PkrI GCNGC 1 cut(s) 39
PleI GAGTC 1 cut(s) 106
PpsI GAGTC 1 cut(s) 106
Psp6I CCWGG 1 cut(s) 4
PspGI CCWGG 1 cut(s) 4
PspPI GGNCC 1 cut(s) 29
PstNI CAGNNNCTG 1 cut(s) 176
RsaI GTAC 1 cut(s) 14
RsaNI GTAC 1 cut(s) 13
SatI GCNGC 1 cut(s) 38
Sau96I GGNCC 1 cut(s) 29
SchI GAGTC 1 cut(s) 107
ScrFI CCNGG 1 cut(s) 6
SetI ASST 3 cut(s) 14, 136, 178
SgeI CNNG 8 cut(s) 17, 18, 75, 91, 152, 161, 166, 173
SinI GGWCC 1 cut(s) 29
StyD4I CCNGG 1 cut(s) 4
TaiI ACGT 1 cut(s) 14
TseI GCWGC 1 cut(s) 37
TspDTI ATGAA 1 cut(s) 123
TspGWI ACGGA 1 cut(s) 42
VpaK11BI GGWCC 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.