AT1G05065

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Reverse (-)
1454606 .. 1455322
717 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G05065.1

Sequence Viewer

Length: 252 bp
ATGAAAAATAAAAATATGAATCCGAGTCGTCCTCGTCTTCTCTGTCTCATTGTTTTTCTCTTCCTCGTTATTGTTCTATCTAAAGCTTCAAGAATCCACGTCGAAAGACGACGCTTCTCATCCAAACCTTCTGGTGAAAACAGAGAGTTTCTCCCTTCACAACCTACTTTTCCGGTCGTCGACGCCGGTGAAATCCTACCGGATAAACGGAAGGTTAAGACGGGATCAAACCCTTTGCACAACAAACGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

9.54

Weight (kDa)

11.27

Isoelectric Point (pI)

67.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022087)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G05065
prunus_persica Prupe.3G212800_v2.0.a1
pyrus_communis pycom09g03650
rosa_chinensis RchiOBHm_Chr2g0158481

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 180
AclWI GGATC 1 cut(s) 232
AcyI GRCGYC 1 cut(s) 183
AgsI TTSAA 1 cut(s) 90
AjiI CACGTC 1 cut(s) 100
AluBI AGCT 1 cut(s) 86
AluI AGCT 1 cut(s) 86
Alw26I GTCTC 1 cut(s) 50
AlwI GGATC 1 cut(s) 232
AsuHPI GGTGA 2 cut(s) 146, 200
BbsI GAAGAC 1 cut(s) 29
BcoDI GTCTC 1 cut(s) 50
BmgBI CACGTC 1 cut(s) 100
BpiI GAAGAC 1 cut(s) 29
BplI GAGNNNNNCTC 4 cut(s) 16, 48, 135, 167
BsaHI GRCGYC 1 cut(s) 183
BsaWI WCCGGW 2 cut(s) 172, 199
Bse118I RCCGGY 1 cut(s) 185
BseGI GGATG 1 cut(s) 119
Bsh1285I CGRYCG 1 cut(s) 177
BsiEI CGRYCG 1 cut(s) 177
BsiSI CCGG 3 cut(s) 173, 186, 200
BsmAI GTCTC 1 cut(s) 50
Bsp143I GATC 1 cut(s) 224
BspPI GGATC 1 cut(s) 232
BsrFI RCCGGY 1 cut(s) 185
BssAI RCCGGY 1 cut(s) 185
BssMI GATC 1 cut(s) 224
BssNI GRCGYC 1 cut(s) 183
Bst6I CTCTTC 1 cut(s) 65
BstACI GRCGYC 1 cut(s) 183
BstF5I GGATG 1 cut(s) 119
BstKTI GATC 1 cut(s) 227
BstMAI GTCTC 1 cut(s) 50
BstMBI GATC 1 cut(s) 224
BstMCI CGRYCG 1 cut(s) 177
BstV2I GAAGAC 1 cut(s) 29
BtrI CACGTC 1 cut(s) 100
BtsCI GGATG 1 cut(s) 119
Cfr10I RCCGGY 1 cut(s) 185
CseI GACGC 2 cut(s) 120, 191
CviJI RGCY 1 cut(s) 86
CviKI_1 RGCY 1 cut(s) 86
DpnI GATC 1 cut(s) 226
DpnII GATC 1 cut(s) 224
Eam1104I CTCTTC 1 cut(s) 65
EarI CTCTTC 1 cut(s) 65
FaiI YATR 1 cut(s) 17
FblI GTMKAC 1 cut(s) 180
FokI GGATG 1 cut(s) 106
HapII CCGG 3 cut(s) 173, 186, 200
HgaI GACGC 2 cut(s) 120, 191
Hin1I GRCGYC 1 cut(s) 183
HincII GTYRAC 1 cut(s) 181
HindII GTYRAC 1 cut(s) 181
HindIII AAGCTT 1 cut(s) 84
HinfI GANTC 3 cut(s) 19, 25, 93
HpaII CCGG 3 cut(s) 173, 186, 200
HphI GGTGA 2 cut(s) 146, 200
Hpy166II GTNNAC 1 cut(s) 181
Hpy188I TCNGA 1 cut(s) 24
Hpy188III TCNNGA 1 cut(s) 90
Hpy8I GTNNAC 1 cut(s) 181
Hpy99I CGWCG 4 cut(s) 104, 114, 182, 185
HpyAV CCTTC 3 cut(s) 138, 165, 205
HpyCH4IV ACGT 1 cut(s) 99
HpyCH4V TGCA 1 cut(s) 238
HpySE526I ACGT 1 cut(s) 99
Hsp92I GRCGYC 1 cut(s) 183
Kzo9I GATC 1 cut(s) 224
LpnPI CCDG 4 cut(s) 117, 186, 199, 213
MaeII ACGT 1 cut(s) 99
MalI GATC 1 cut(s) 226
MboI GATC 1 cut(s) 224
MboII GAAGA 2 cut(s) 29, 52
MlyI GAGTC 1 cut(s) 34
MnlI CCTC 2 cut(s) 42, 74
MseI TTAA 1 cut(s) 216
MspI CCGG 3 cut(s) 173, 186, 200
NdeII GATC 1 cut(s) 224
PfeI GAWTC 2 cut(s) 19, 93
PleI GAGTC 1 cut(s) 33
PpsI GAGTC 1 cut(s) 33
SalI GTCGAC 1 cut(s) 179
SaqAI TTAA 1 cut(s) 216
Sau3AI GATC 1 cut(s) 224
SchI GAGTC 1 cut(s) 34
SetI ASST 5 cut(s) 88, 102, 130, 166, 216
SgrAI CRCCGGYG 1 cut(s) 185
SgrDI CGTCGACG 1 cut(s) 179
TaiI ACGT 1 cut(s) 102
TaqI TCGA 2 cut(s) 102, 180
TfiI GAWTC 2 cut(s) 19, 93
Tru1I TTAA 1 cut(s) 216
Tru9I TTAA 1 cut(s) 216
TspDTI ATGAA 2 cut(s) 17, 32
TspGWI ACGGA 1 cut(s) 223
XmiI GTMKAC 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.