pycom09g03650

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Forward (+)
2705524 .. 2706099
576 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g03650.2

Sequence Viewer

Length: 372 bp
ATGATCATCACCAAATGGACGGTTGTACCATTTCACCATGCCTTTGATCATCACTCACAGACATTCTTCTTCAAATTTCACAGCATGAATCGCTTTCAAATCTTCCTCCTTTTTGCTTTGCTGATCCCCCTCTTTGTTCCAAGAACTCATGCAATTCGGAGAAGCTTTCCGAGCCCATCTTCGGCAAGAAGCCAACAGGTTTTCAGGCCATCAATGACTAGTGCTCCCTCTACCAAAGATCAAGCCAGAGATTTCGTTTCCGAGGAGCGAAGGGTTCCGACAGGATCAAACCCTTTACACAACAAGCGATCGATCTTTCAAGTTTTTGAAGAACTCCCATTTCCAGATAAACACACATATTTATCTAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

124

Amino Acids

14.45

Weight (kDa)

10.88

Isoelectric Point (pI)

70.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022087)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G05065
prunus_persica Prupe.3G212800_v2.0.a1
pyrus_communis pycom09g03650
rosa_chinensis RchiOBHm_Chr2g0158481

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 118, 292
AcsI RAATTY 1 cut(s) 74
AfaI GTAC 1 cut(s) 27
AfiI CCNNNNNNNGG 1 cut(s) 181
AgsI TTSAA 4 cut(s) 73, 98, 320, 329
AhlI ACTAGT 1 cut(s) 218
AluBI AGCT 2 cut(s) 165, 369
AluI AGCT 2 cut(s) 165, 369
Alw21I GWGCWC 1 cut(s) 226
AlwI GGATC 2 cut(s) 118, 292
AoxI GGCC 1 cut(s) 206
ApoI RAATTY 1 cut(s) 74
AsuHPI GGTGA 1 cut(s) 26
BaeI ACNNNNGTAYC 2 cut(s) 9, 42
BanII GRGCYC 1 cut(s) 176
Bbv12I GWGCWC 1 cut(s) 226
BccI CCATC 2 cut(s) 184, 217
BclI TGATCA 2 cut(s) 3, 46
BcuI ACTAGT 1 cut(s) 218
BfaI CTAG 3 cut(s) 219, 366, 370
BmiI GGNNCC 1 cut(s) 276
Bsa29I ATCGAT 1 cut(s) 311
BsaJI CCNNGG 1 cut(s) 261
BsaXI ACNNNNNCTCC 2 cut(s) 208, 238
Bsc4I CCNNNNNNNGG 1 cut(s) 181
BseCI ATCGAT 1 cut(s) 311
BseDI CCNNGG 1 cut(s) 261
BseLI CCNNNNNNNGG 1 cut(s) 181
BseRI GAGGAG 1 cut(s) 278
Bsh1285I CGRYCG 1 cut(s) 311
BshFI GGCC 1 cut(s) 208
BshVI ATCGAT 1 cut(s) 311
BsiEI CGRYCG 1 cut(s) 311
BsiHKAI GWGCWC 1 cut(s) 226
BslI CCNNNNNNNGG 1 cut(s) 181
BsnI GGCC 1 cut(s) 208
Bsp1286I GDGCHC 2 cut(s) 176, 226
Bsp143I GATC 7 cut(s) 3, 46, 123, 238, 284, 308, 312
BspANI GGCC 1 cut(s) 208
BspDI ATCGAT 1 cut(s) 311
BspLI GGNNCC 1 cut(s) 276
BspPI GGATC 2 cut(s) 118, 292
BssECI CCNNGG 1 cut(s) 261
BssMI GATC 7 cut(s) 3, 46, 123, 238, 284, 308, 312
Bst4CI ACNGT 1 cut(s) 22
BstKTI GATC 7 cut(s) 6, 49, 126, 241, 287, 311, 315
BstMBI GATC 7 cut(s) 3, 46, 123, 238, 284, 308, 312
BstMCI CGRYCG 1 cut(s) 311
BstMWI GCNNNNNNNGC 2 cut(s) 90, 171
Bsu15I ATCGAT 1 cut(s) 311
BsuRI GGCC 1 cut(s) 208
BsuTUI ATCGAT 1 cut(s) 311
ClaI ATCGAT 1 cut(s) 311
Csp6I GTAC 1 cut(s) 26
CviAII CATG 3 cut(s) 38, 85, 149
CviJI RGCY 6 cut(s) 165, 174, 192, 208, 245, 369
CviKI_1 RGCY 6 cut(s) 165, 174, 192, 208, 245, 369
CviQI GTAC 1 cut(s) 26
DpnI GATC 7 cut(s) 5, 48, 125, 240, 286, 310, 314
DpnII GATC 7 cut(s) 3, 46, 123, 238, 284, 308, 312
Eco24I GRGCYC 1 cut(s) 176
EcoT38I GRGCYC 1 cut(s) 176
FaeI CATG 3 cut(s) 41, 88, 152
FaiI YATR 4 cut(s) 39, 86, 150, 358
FatI CATG 3 cut(s) 37, 84, 148
FbaI TGATCA 2 cut(s) 3, 46
FriOI GRGCYC 1 cut(s) 176
FspBI CTAG 3 cut(s) 219, 366, 370
HaeIII GGCC 1 cut(s) 208
Hin1II CATG 3 cut(s) 41, 88, 152
HindIII AAGCTT 1 cut(s) 163
HinfI GANTC 1 cut(s) 88
HphI GGTGA 1 cut(s) 26
Hpy188I TCNGA 4 cut(s) 159, 171, 262, 279
Hpy188III TCNNGA 1 cut(s) 344
HpyAV CCTTC 1 cut(s) 264
HpyCH4III ACNGT 1 cut(s) 22
HpyCH4V TGCA 1 cut(s) 152
HpyF10VI GCNNNNNNNGC 2 cut(s) 90, 171
Hsp92II CATG 3 cut(s) 41, 88, 152
Ksp22I TGATCA 2 cut(s) 3, 46
Kzo9I GATC 7 cut(s) 3, 46, 123, 238, 284, 308, 312
LmnI GCTCC 2 cut(s) 229, 265
LpnPI CCDG 5 cut(s) 182, 190, 259, 267, 357
MaeI CTAG 3 cut(s) 219, 366, 370
MalI GATC 7 cut(s) 5, 48, 125, 240, 286, 310, 314
MboI GATC 7 cut(s) 3, 46, 123, 238, 284, 308, 312
MboII GAAGA 5 cut(s) 58, 61, 94, 171, 341
MhlI GDGCHC 2 cut(s) 176, 226
MluCI AATT 2 cut(s) 74, 153
MmeI TCCRAC 1 cut(s) 302
MnlI CCTC 4 cut(s) 116, 140, 238, 256
MwoI GCNNNNNNNGC 2 cut(s) 90, 171
NdeII GATC 7 cut(s) 3, 46, 123, 238, 284, 308, 312
NlaIII CATG 3 cut(s) 41, 88, 152
NlaIV GGNNCC 1 cut(s) 276
PfeI GAWTC 1 cut(s) 88
Ple19I CGATCG 1 cut(s) 311
PspN4I GGNNCC 1 cut(s) 276
PvuI CGATCG 1 cut(s) 311
RsaI GTAC 1 cut(s) 27
RsaNI GTAC 1 cut(s) 26
Sau3AI GATC 7 cut(s) 3, 46, 123, 238, 284, 308, 312
SduI GDGCHC 2 cut(s) 176, 226
SetI ASST 3 cut(s) 167, 201, 371
SpeI ACTAGT 1 cut(s) 218
Sse9I AATT 2 cut(s) 74, 153
SspMI CTAG 3 cut(s) 219, 366, 370
TaaI ACNGT 1 cut(s) 22
TaqI TCGA 1 cut(s) 311
TasI AATT 2 cut(s) 74, 153
TfiI GAWTC 1 cut(s) 88
TspDTI ATGAA 1 cut(s) 101
XapI RAATTY 1 cut(s) 74
XspI CTAG 3 cut(s) 219, 366, 370
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.