AT2G04495

Has 30201 Blast hits to 17322 proteins in 780 species Archae - 12

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Forward (+)
1564056 .. 1565137
1082 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G04495.1

Sequence Viewer

Length: 609 bp
ATGGAATCCCAAAAGCTAGGAAGAAAGATGAAGGAGATAAAAATAGTAACTAAGATCATAGCATTGGCATCCATTTTCTCATTTATACTATCTTACTCTTCCTTAATCTCTTCTCTTCAGCAAAGACTCCATTTGCTTTCAATGTATAGCAATCTTGTGGACAAGAAATACATGTTCTTGTTATGCAATGGGATTGTGGGCTTTATCTTGGGGAGTTTCCATGGGAATTCTGAATCCCTTTCGCAGGGTAAAGCCATTAACATCATTGAACAAACGAAAGAAGTAGGGATCAAAGACTTGAAAGAAACAAAACTCAAGAAGGTAGTGGCATTACTTGAAGAAAAGAGTGTTTCTAAAGAAGAAGAAGAAGAAGAAGAAGGAGGAAGAGTTGTTTTATTTAGAGGAATCGAAGAAGAAGAAGTGTCATTGGTTGTTGAGGTAGATGAGGAAATATTAGTACAAGACCTCGCTATCATTAGAGTAGATGATCATCATGATGACGAAGAGATAAATGATAGTTTACTAAGTGTCGAAGATTTGAACAAGAAATGTGAGGATTTCATCAGGAAGATGAAAGCAGAGATTCAATTCGGGAAGAGAAGTATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

202

Amino Acids

22.99

Weight (kDa)

5.05

Isoelectric Point (pI)

55.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017101)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G04495 AT2G04515
fragaria_vesca FvH4_6g40700
prunus_persica Prupe.3G198500_v2.0.a1
pyrus_communis pycom09g05040 pycom17g10730
rosa_laevigata RLG00000020890
rosa_roxburghii Rroxscaffold_2G00093210
rosa_rugosa Rorug02G0451900
rosa_samantha Rh2BG529800 Rh2CG503500 Rh2DG538900
rosa_wichuraiana Rw2G042700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 296
AcsI RAATTY 1 cut(s) 226
AcuI CTGAAG 1 cut(s) 101
AfaI GTAC 1 cut(s) 459
AfiI CCNNNNNNNGG 1 cut(s) 244
AflIII ACRYGT 1 cut(s) 171
AgsI TTSAA 6 cut(s) 141, 269, 301, 338, 541, 587
AluBI AGCT 1 cut(s) 16
AluI AGCT 1 cut(s) 16
AlwI GGATC 1 cut(s) 296
ApoI RAATTY 1 cut(s) 226
BclI TGATCA 1 cut(s) 487
BfaI CTAG 1 cut(s) 17
BmsI GCATC 1 cut(s) 77
BpuEI CTTGAG 1 cut(s) 299
BsaBI GATNNNNATC 1 cut(s) 489
BsaJI CCNNGG 1 cut(s) 220
BsaXI ACNNNNNCTCC 2 cut(s) 372, 402
Bsc4I CCNNNNNNNGG 1 cut(s) 244
Bse3DI GCAATG 1 cut(s) 193
Bse8I GATNNNNATC 1 cut(s) 489
BseDI CCNNGG 1 cut(s) 220
BseGI GGATG 1 cut(s) 68
BseJI GATNNNNATC 1 cut(s) 489
BseLI CCNNNNNNNGG 1 cut(s) 244
BseMI GCAATG 1 cut(s) 193
BslI CCNNNNNNNGG 1 cut(s) 244
Bsp143I GATC 3 cut(s) 54, 288, 487
Bsp19I CCATGG 1 cut(s) 220
BspHI TCATGA 1 cut(s) 493
BspPI GGATC 1 cut(s) 296
BsrDI GCAATG 1 cut(s) 193
BssECI CCNNGG 1 cut(s) 220
BssMI GATC 3 cut(s) 54, 288, 487
BssT1I CCWWGG 1 cut(s) 220
Bst6I CTCTTC 6 cut(s) 103, 115, 120, 379, 498, 590
BstDEI CTNAG 2 cut(s) 51, 524
BstDSI CCRYGG 1 cut(s) 220
BstENI CCTNNNNNAGG 1 cut(s) 242
BstF5I GGATG 1 cut(s) 68
BstKTI GATC 3 cut(s) 57, 291, 490
BstMBI GATC 3 cut(s) 54, 288, 487
BstNSI RCATGY 1 cut(s) 175
BtgI CCRYGG 1 cut(s) 220
BtsCI GGATG 1 cut(s) 68
CciI TCATGA 1 cut(s) 493
Csp6I GTAC 1 cut(s) 458
CviAII CATG 3 cut(s) 172, 221, 494
CviJI RGCY 3 cut(s) 16, 201, 254
CviKI_1 RGCY 3 cut(s) 16, 201, 254
CviQI GTAC 1 cut(s) 458
DdeI CTNAG 2 cut(s) 51, 524
DpnI GATC 3 cut(s) 56, 290, 489
DpnII GATC 3 cut(s) 54, 288, 487
Eam1104I CTCTTC 6 cut(s) 103, 115, 120, 379, 498, 590
EarI CTCTTC 6 cut(s) 103, 115, 120, 379, 498, 590
Eco130I CCWWGG 1 cut(s) 220
Eco57I CTGAAG 1 cut(s) 101
EcoNI CCTNNNNNAGG 1 cut(s) 242
EcoRI GAATTC 1 cut(s) 226
EcoT14I CCWWGG 1 cut(s) 220
ErhI CCWWGG 1 cut(s) 220
FaeI CATG 3 cut(s) 175, 224, 497
FaiI YATR 9 cut(s) 59, 86, 147, 173, 184, 222, 495, 605, 607
FatI CATG 3 cut(s) 171, 220, 493
FbaI TGATCA 1 cut(s) 487
FokI GGATG 1 cut(s) 55
FspBI CTAG 1 cut(s) 17
Hin1II CATG 3 cut(s) 175, 224, 497
HinfI GANTC 5 cut(s) 5, 126, 233, 405, 583
Hpy166II GTNNAC 2 cut(s) 160, 521
Hpy188I TCNGA 1 cut(s) 232
Hpy188III TCNNGA 4 cut(s) 316, 494, 565, 592
Hpy8I GTNNAC 2 cut(s) 160, 521
HpyAV CCTTC 3 cut(s) 25, 313, 371
HpyCH4V TGCA 1 cut(s) 186
HpyF3I CTNAG 2 cut(s) 51, 524
Hsp92II CATG 3 cut(s) 175, 224, 497
Ksp22I TGATCA 1 cut(s) 487
Kzo9I GATC 3 cut(s) 54, 288, 487
LpnPI CCDG 2 cut(s) 230, 550
LweI GCATC 1 cut(s) 77
MaeI CTAG 1 cut(s) 17
MaeIII GTNAC 1 cut(s) 46
MalI GATC 3 cut(s) 56, 290, 489
MboI GATC 3 cut(s) 54, 288, 487
MluCI AATT 2 cut(s) 226, 587
MlyI GAGTC 1 cut(s) 120
MnlI CCTC 6 cut(s) 374, 395, 430, 439, 476, 547
MseI TTAA 2 cut(s) 104, 258
MslI CAYNNNNRTG 1 cut(s) 495
NcoI CCATGG 1 cut(s) 220
NdeII GATC 3 cut(s) 54, 288, 487
NlaIII CATG 3 cut(s) 175, 224, 497
NspI RCATGY 1 cut(s) 175
PagI TCATGA 1 cut(s) 493
PciI ACATGT 1 cut(s) 171
PfeI GAWTC 4 cut(s) 5, 233, 405, 583
PleI GAGTC 1 cut(s) 120
PpsI GAGTC 1 cut(s) 120
PscI ACATGT 1 cut(s) 171
RsaI GTAC 1 cut(s) 459
RsaNI GTAC 1 cut(s) 458
RseI CAYNNNNRTG 1 cut(s) 495
SaqAI TTAA 2 cut(s) 104, 258
Sau3AI GATC 3 cut(s) 54, 288, 487
SchI GAGTC 1 cut(s) 120
SetI ASST 4 cut(s) 18, 324, 441, 468
SfaNI GCATC 1 cut(s) 77
SmiMI CAYNNNNRTG 1 cut(s) 495
SmlI CTYRAG 1 cut(s) 314
SmoI CTYRAG 1 cut(s) 314
Sse9I AATT 2 cut(s) 226, 587
SspI AATATT 1 cut(s) 453
SspMI CTAG 1 cut(s) 17
StyI CCWWGG 1 cut(s) 220
TaqI TCGA 2 cut(s) 408, 531
TasI AATT 2 cut(s) 226, 587
TatI WGTACW 1 cut(s) 457
TfiI GAWTC 4 cut(s) 5, 233, 405, 583
Tru1I TTAA 2 cut(s) 104, 258
Tru9I TTAA 2 cut(s) 104, 258
TspDTI ATGAA 3 cut(s) 44, 550, 587
XagI CCTNNNNNAGG 1 cut(s) 242
XapI RAATTY 1 cut(s) 226
XceI RCATGY 1 cut(s) 175
XspI CTAG 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.