AT5G12235

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Forward (+)
3957521 .. 3958129
609 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G12235.1

Sequence Viewer

Length: 312 bp
ATGGGAAATTACTACTCTAGAAGAAAATCTAGGAAACACATCACTACAGTTGCCTTGATCATCCTTCTTCTTCTTTTGTTTCTGTTTCTTTACGCTAAAGCTTCATCGTCTTCTCCTAATATACATCATCACTCAACTCATGGAAGCTTGAAGAAATCTGGAAATTTGGATCCAAAGCTTCATGATCTTGACTCCAATGCTGCGTCATCAAGAGGATCAAAATATACTAATTATGAAGGTGGTGGTGAAGATGTTTTTGAAGATGGCAAGAGAAGGGTCTTCACAGGTCCTAATCCATTGCACAATAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

11.51

Weight (kDa)

9.93

Isoelectric Point (pI)

56.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023604)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G12235
prunus_persica Prupe.7G031000_v2.0.a1
pyrus_communis pycom14g08400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 164, 177, 223
AcsI RAATTY 1 cut(s) 163
AgsI TTSAA 2 cut(s) 151, 260
AluBI AGCT 3 cut(s) 101, 147, 178
AluI AGCT 3 cut(s) 101, 147, 178
AlwI GGATC 3 cut(s) 164, 177, 223
ApeKI GCWGC 1 cut(s) 200
ApoI RAATTY 1 cut(s) 163
AspS9I GGNCC 1 cut(s) 287
AsuHPI GGTGA 1 cut(s) 257
AvaII GGWCC 1 cut(s) 287
BamHI GGATCC 1 cut(s) 169
BbsI GAAGAC 2 cut(s) 102, 271
BbvI GCAGC 1 cut(s) 187
BccI CCATC 1 cut(s) 257
BclI TGATCA 1 cut(s) 57
BfaI CTAG 2 cut(s) 18, 30
BfmI CTRYAG 1 cut(s) 45
BisI GCNGC 1 cut(s) 201
BlsI GCNGC 1 cut(s) 202
Bme18I GGWCC 1 cut(s) 287
BmgT120I GGNCC 1 cut(s) 287
BmiI GGNNCC 1 cut(s) 171
BpiI GAAGAC 2 cut(s) 102, 271
Bse3DI GCAATG 1 cut(s) 296
BseGI GGATG 1 cut(s) 60
BseMI GCAATG 1 cut(s) 296
BseXI GCAGC 1 cut(s) 187
Bsp143I GATC 4 cut(s) 57, 169, 184, 215
BspHI TCATGA 1 cut(s) 181
BspLI GGNNCC 1 cut(s) 171
BspPI GGATC 3 cut(s) 164, 177, 223
BsrDI GCAATG 1 cut(s) 296
BssMI GATC 4 cut(s) 57, 169, 184, 215
Bst4CI ACNGT 1 cut(s) 49
BstF5I GGATG 1 cut(s) 60
BstKTI GATC 4 cut(s) 60, 172, 187, 218
BstMBI GATC 4 cut(s) 57, 169, 184, 215
BstSFI CTRYAG 1 cut(s) 45
BstV1I GCAGC 1 cut(s) 187
BstV2I GAAGAC 2 cut(s) 102, 271
BstX2I RGATCY 1 cut(s) 169
BstYI RGATCY 1 cut(s) 169
BtsCI GGATG 1 cut(s) 60
CciI TCATGA 1 cut(s) 181
Cfr13I GGNCC 1 cut(s) 287
CseI GACGC 1 cut(s) 192
CviAII CATG 2 cut(s) 140, 182
CviJI RGCY 3 cut(s) 101, 147, 178
CviKI_1 RGCY 3 cut(s) 101, 147, 178
DpnI GATC 4 cut(s) 59, 171, 186, 217
DpnII GATC 4 cut(s) 57, 169, 184, 215
Eco47I GGWCC 1 cut(s) 287
EcoO109I RGGNCCY 1 cut(s) 287
FaeI CATG 2 cut(s) 143, 185
FaiI YATR 5 cut(s) 122, 141, 183, 225, 234
FatI CATG 2 cut(s) 139, 181
FbaI TGATCA 1 cut(s) 57
Fnu4HI GCNGC 1 cut(s) 201
FokI GGATG 1 cut(s) 47
Fsp4HI GCNGC 1 cut(s) 201
FspBI CTAG 2 cut(s) 18, 30
GluI GCNGC 1 cut(s) 201
HgaI GACGC 1 cut(s) 192
Hin1II CATG 2 cut(s) 143, 185
HindIII AAGCTT 3 cut(s) 99, 145, 176
HinfI GANTC 1 cut(s) 191
HphI GGTGA 1 cut(s) 257
Hpy188III TCNNGA 5 cut(s) 18, 159, 182, 188, 210
HpyAV CCTTC 3 cut(s) 74, 230, 267
HpyCH4III ACNGT 1 cut(s) 49
HpyCH4V TGCA 1 cut(s) 301
Hsp92II CATG 2 cut(s) 143, 185
Ksp22I TGATCA 1 cut(s) 57
Kzo9I GATC 4 cut(s) 57, 169, 184, 215
LpnPI CCDG 2 cut(s) 144, 270
Lsp1109I GCAGC 1 cut(s) 187
MaeI CTAG 2 cut(s) 18, 30
MalI GATC 4 cut(s) 59, 171, 186, 217
MboI GATC 4 cut(s) 57, 169, 184, 215
MboII GAAGA 8 cut(s) 33, 59, 62, 102, 163, 260, 271, 272
MflI RGATCY 1 cut(s) 169
MluCI AATT 3 cut(s) 7, 163, 229
MlyI GAGTC 1 cut(s) 185
MnlI CCTC 1 cut(s) 206
NdeII GATC 4 cut(s) 57, 169, 184, 215
NlaIII CATG 2 cut(s) 143, 185
NlaIV GGNNCC 1 cut(s) 171
PagI TCATGA 1 cut(s) 181
PkrI GCNGC 1 cut(s) 202
PleI GAGTC 1 cut(s) 185
PpsI GAGTC 1 cut(s) 185
PpuMI RGGWCCY 1 cut(s) 287
Psp5II RGGWCCY 1 cut(s) 287
PspN4I GGNNCC 1 cut(s) 171
PspPI GGNCC 1 cut(s) 287
PspPPI RGGWCCY 1 cut(s) 287
PsuI RGATCY 1 cut(s) 169
SatI GCNGC 1 cut(s) 201
Sau3AI GATC 4 cut(s) 57, 169, 184, 215
Sau96I GGNCC 1 cut(s) 287
SchI GAGTC 1 cut(s) 185
SetI ASST 5 cut(s) 103, 149, 180, 241, 289
SfcI CTRYAG 1 cut(s) 45
SinI GGWCC 1 cut(s) 287
Sse9I AATT 3 cut(s) 7, 163, 229
SspMI CTAG 2 cut(s) 18, 30
TaaI ACNGT 1 cut(s) 49
TasI AATT 3 cut(s) 7, 163, 229
TseI GCWGC 1 cut(s) 200
TspDTI ATGAA 3 cut(s) 93, 170, 249
VpaK11BI GGWCC 1 cut(s) 287
XapI RAATTY 1 cut(s) 163
XbaI TCTAGA 1 cut(s) 17
XspI CTAG 2 cut(s) 18, 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.