Prupe.7G031000_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Forward (+)
5719398 .. 5720484
1087 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G031000.1

Sequence Viewer

Length: 288 bp
ATGAAATATTTGGTTAAGAGAAGAAAGCAGATGAGCCTGAAAACAGAGCTGGCCTGCTTGTCTTTGCTTGTTCTGATTCTACTTCAGCTGGAGACTCCAAGCTTAGCAGCTGGAAATGAAAAGTCAACCACAGTCAAAGCTGCTCCAACAAAAGCTTCTGAATTCAACCCAGCTAAGCCTCAAGTTGGTGGGTTTAAAAGAAATGCAGAAAAAGATGGAAATGATGAAATTTTTGGTGCTGATAAGAGGACCATCTACACTGGCCCAAATCCTCTGCACAATAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.47

Weight (kDa)

9.81

Isoelectric Point (pI)

52.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023604)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G12235
prunus_persica Prupe.7G031000_v2.0.a1
pyrus_communis pycom14g08400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 161, 228
AcuI CTGAAG 1 cut(s) 68
AfiI CCNNNNNNNGG 1 cut(s) 185
AgsI TTSAA 1 cut(s) 166
AjuI GAANNNNNNNTTGG 2 cut(s) 139, 171
AluBI AGCT 7 cut(s) 49, 88, 102, 110, 140, 155, 173
AluI AGCT 7 cut(s) 49, 88, 102, 110, 140, 155, 173
Alw26I GTCTC 1 cut(s) 86
AoxI GGCC 2 cut(s) 51, 262
ApeKI GCWGC 2 cut(s) 107, 140
ApoI RAATTY 2 cut(s) 161, 228
AspS9I GGNCC 2 cut(s) 249, 263
AvaII GGWCC 1 cut(s) 249
BbvI GCAGC 2 cut(s) 119, 127
BccI CCATC 2 cut(s) 209, 260
BcoDI GTCTC 1 cut(s) 86
BisI GCNGC 2 cut(s) 108, 141
BlpI GCTNAGC 2 cut(s) 103, 174
BlsI GCNGC 2 cut(s) 109, 142
Bme18I GGWCC 1 cut(s) 249
BmgT120I GGNCC 2 cut(s) 249, 263
BpmI CTGGAG 1 cut(s) 110
Bpu1102I GCTNAGC 2 cut(s) 103, 174
BpuEI CTTGAG 1 cut(s) 165
Bsc4I CCNNNNNNNGG 1 cut(s) 185
Bse1I ACTGG 1 cut(s) 265
BseLI CCNNNNNNNGG 1 cut(s) 185
BseNI ACTGG 1 cut(s) 265
BseXI GCAGC 2 cut(s) 119, 127
BseYI CCCAGC 1 cut(s) 169
BsgI GTGCAG 1 cut(s) 260
BshFI GGCC 2 cut(s) 53, 264
BslI CCNNNNNNNGG 1 cut(s) 185
BsmAI GTCTC 1 cut(s) 86
BsnI GGCC 2 cut(s) 53, 264
Bsp1720I GCTNAGC 2 cut(s) 103, 174
BspANI GGCC 2 cut(s) 53, 264
BsrI ACTGG 1 cut(s) 265
Bst4CI ACNGT 1 cut(s) 133
BstC8I GCNNGC 2 cut(s) 51, 55
BstDEI CTNAG 2 cut(s) 103, 174
BstMAI GTCTC 1 cut(s) 86
BstV1I GCAGC 2 cut(s) 119, 127
BsuRI GGCC 2 cut(s) 53, 264
BtsIMutI CAGTG 1 cut(s) 258
Cac8I GCNNGC 2 cut(s) 51, 55
Cfr13I GGNCC 2 cut(s) 249, 263
DdeI CTNAG 2 cut(s) 103, 174
DraI TTTAAA 1 cut(s) 196
Eco47I GGWCC 1 cut(s) 249
Eco57I CTGAAG 1 cut(s) 68
EcoRI GAATTC 1 cut(s) 161
Fnu4HI GCNGC 2 cut(s) 108, 141
Fsp4HI GCNGC 2 cut(s) 108, 141
GluI GCNGC 2 cut(s) 108, 141
GsaI CCCAGC 1 cut(s) 173
GsuI CTGGAG 1 cut(s) 110
HaeIII GGCC 2 cut(s) 53, 264
HincII GTYRAC 1 cut(s) 126
HindII GTYRAC 1 cut(s) 126
HindIII AAGCTT 2 cut(s) 100, 153
HinfI GANTC 2 cut(s) 76, 94
Hpy166II GTNNAC 1 cut(s) 126
Hpy188I TCNGA 2 cut(s) 75, 160
Hpy8I GTNNAC 1 cut(s) 126
HpyCH4III ACNGT 1 cut(s) 133
HpyCH4V TGCA 2 cut(s) 206, 277
HpyF3I CTNAG 2 cut(s) 103, 174
LmnI GCTCC 1 cut(s) 148
LpnPI CCDG 7 cut(s) 35, 50, 67, 74, 96, 183, 246
Lsp1109I GCAGC 2 cut(s) 119, 127
MboII GAAGA 1 cut(s) 33
MluCI AATT 2 cut(s) 161, 228
MlyI GAGTC 1 cut(s) 88
MmeI TCCRAC 1 cut(s) 170
MnlI CCTC 3 cut(s) 189, 240, 282
MseI TTAA 2 cut(s) 15, 195
MspA1I CMGCKG 2 cut(s) 88, 110
PfeI GAWTC 1 cut(s) 76
PkrI GCNGC 2 cut(s) 109, 142
PleI GAGTC 1 cut(s) 88
PpsI GAGTC 1 cut(s) 88
PspFI CCCAGC 1 cut(s) 169
PspPI GGNCC 2 cut(s) 249, 263
PvuII CAGCTG 2 cut(s) 88, 110
SaqAI TTAA 2 cut(s) 15, 195
SatI GCNGC 2 cut(s) 108, 141
Sau96I GGNCC 2 cut(s) 249, 263
SchI GAGTC 1 cut(s) 88
SetI ASST 7 cut(s) 51, 90, 104, 112, 142, 157, 175
SinI GGWCC 1 cut(s) 249
SmlI CTYRAG 1 cut(s) 180
SmoI CTYRAG 1 cut(s) 180
Sse9I AATT 2 cut(s) 161, 228
SspI AATATT 1 cut(s) 8
TaaI ACNGT 1 cut(s) 133
TasI AATT 2 cut(s) 161, 228
TfiI GAWTC 1 cut(s) 76
Tru1I TTAA 2 cut(s) 15, 195
Tru9I TTAA 2 cut(s) 15, 195
TscAI CASTG 1 cut(s) 265
TseI GCWGC 2 cut(s) 107, 140
TspDTI ATGAA 3 cut(s) 17, 132, 240
TspRI CASTG 1 cut(s) 265
VpaK11BI GGWCC 1 cut(s) 249
XapI RAATTY 2 cut(s) 161, 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.