ATCG00550

One of the components of the core complex of photosystem II (PSII). PSII is a light-driven water plastoquinone oxidoreductase that uses light energy to abstract electrons from H(2)O, generating O(2) and a proton gradient subsequently used for ATP formation. It consists of a core antenna complex that captures photons, and an electron transfer chain that converts photonic excitation into a charge separation

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
Pt
OG0021992
Physical Location & Seq
Reverse (-)
63538 .. 63660
123 bp
Loading structure...
UTR
Exon/CDS
Intron
ATCG00550.1

Sequence Viewer

Length: 123 bp
ATGGCTGATACTACTGGAAGGATTCCTCTTTGGGTAATAGGTACTGTAGCTGGTATTCTTGTGATCGGTTTAATAGGTATTTTCTTTTATGGTTCATATTCAGGATTAGGTTCATCCCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00195 ko01100 map00195 map01100
Pfam Domains
Protein Families
PsbJ

Protein Analysis

40

Amino Acids

4.12

Weight (kDa)

5.59

Isoelectric Point (pI)

17.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsbJ PF01788 3 - 40 1.3e-22 PsbJ
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021992)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00550
malus_domestica MD06G1065900.v1.1
rosa_chinensis RchiOBHm_Chr7g0202431 RchiOBHm_CPg0502061

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 43
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
BfmI CTRYAG 2 cut(s) 45, 119
Bse1I ACTGG 1 cut(s) 19
BseGI GGATG 1 cut(s) 113
BseNI ACTGG 1 cut(s) 19
Bsp143I GATC 1 cut(s) 63
BsrI ACTGG 1 cut(s) 19
BssMI GATC 1 cut(s) 63
Bst4CI ACNGT 1 cut(s) 46
BstF5I GGATG 1 cut(s) 113
BstKTI GATC 1 cut(s) 66
BstMBI GATC 1 cut(s) 63
BstSFI CTRYAG 2 cut(s) 45, 119
BtsCI GGATG 1 cut(s) 113
Csp6I GTAC 1 cut(s) 42
CviJI RGCY 2 cut(s) 5, 50
CviKI_1 RGCY 2 cut(s) 5, 50
CviQI GTAC 1 cut(s) 42
DpnI GATC 1 cut(s) 65
DpnII GATC 1 cut(s) 63
FaiI YATR 2 cut(s) 90, 97
FokI GGATG 1 cut(s) 100
HinfI GANTC 1 cut(s) 22
Hpy188III TCNNGA 1 cut(s) 102
HpyAV CCTTC 1 cut(s) 12
HpyCH4III ACNGT 1 cut(s) 46
Kzo9I GATC 1 cut(s) 63
LpnPI CCDG 2 cut(s) 36, 87
MalI GATC 1 cut(s) 65
MboI GATC 1 cut(s) 63
MnlI CCTC 1 cut(s) 36
MseI TTAA 1 cut(s) 71
NdeII GATC 1 cut(s) 63
PfeI GAWTC 1 cut(s) 22
RsaI GTAC 1 cut(s) 43
RsaNI GTAC 1 cut(s) 42
SaqAI TTAA 1 cut(s) 71
Sau3AI GATC 1 cut(s) 63
SetI ASST 4 cut(s) 43, 52, 79, 112
SfcI CTRYAG 2 cut(s) 45, 119
SgeI CNNG 4 cut(s) 27, 63, 71, 114
TaaI ACNGT 1 cut(s) 46
TfiI GAWTC 1 cut(s) 22
Tru1I TTAA 1 cut(s) 71
Tru9I TTAA 1 cut(s) 71
TspDTI ATGAA 2 cut(s) 84, 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.