FvH4_1g02350

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Forward (+)
1279943 .. 1280770
828 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g02350.t1

Sequence Viewer

Length: 201 bp
ATGGTTGACTGGAGAATTGGAATGTTAGCGAAAGAAGAAGAGATGTACGGACGGAGCTACAAGAGGCCTCAGAGGCTGAGCCTAAGCCCAAGAGAACTAAGCATAATTTACTTCAGAAAGAGAACTCTTACGGGTGGAACTGGTTGGTATGATTCACGCCTTAAGACTGGTATGATTCTGCATTTGTTCTGTCTGAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.87

Weight (kDa)

10.0

Isoelectric Point (pI)

60.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023967)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g02350 FvH4_1g21190 FvH4_1g28140

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 97
AfaI GTAC 1 cut(s) 47
AflII CTTAAG 1 cut(s) 161
AluBI AGCT 1 cut(s) 57
AluI AGCT 1 cut(s) 57
AlwNI CAGNNNCTG 1 cut(s) 76
AoxI GGCC 1 cut(s) 65
BfrI CTTAAG 1 cut(s) 161
BglI GCCNNNNNGGC 1 cut(s) 73
BlpI GCTNAGC 1 cut(s) 77
BpmI CTGGAG 1 cut(s) 31
Bpu10I CCTNAGC 1 cut(s) 83
Bpu1102I GCTNAGC 1 cut(s) 77
Bse1I ACTGG 3 cut(s) 14, 145, 172
BseMII CTCAG 2 cut(s) 68, 83
BseNI ACTGG 3 cut(s) 14, 145, 172
BshFI GGCC 1 cut(s) 67
BsnI GGCC 1 cut(s) 67
Bsp1720I GCTNAGC 1 cut(s) 77
BspANI GGCC 1 cut(s) 67
BspCNI CTCAG 2 cut(s) 69, 82
BspTI CTTAAG 1 cut(s) 161
BsrI ACTGG 3 cut(s) 14, 145, 172
Bst6I CTCTTC 1 cut(s) 33
BstAFI CTTAAG 1 cut(s) 161
BstDEI CTNAG 4 cut(s) 69, 77, 83, 98
BstMWI GCNNNNNNNGC 1 cut(s) 73
BsuRI GGCC 1 cut(s) 67
CaiI CAGNNNCTG 1 cut(s) 76
Csp6I GTAC 1 cut(s) 46
CviJI RGCY 5 cut(s) 57, 67, 76, 81, 87
CviKI_1 RGCY 5 cut(s) 57, 67, 76, 81, 87
CviQI GTAC 1 cut(s) 46
DdeI CTNAG 4 cut(s) 69, 77, 83, 98
Eam1104I CTCTTC 1 cut(s) 33
EarI CTCTTC 1 cut(s) 33
Eco147I AGGCCT 1 cut(s) 67
Eco57I CTGAAG 1 cut(s) 97
FaiI YATR 3 cut(s) 104, 150, 173
GsuI CTGGAG 1 cut(s) 31
HaeIII GGCC 1 cut(s) 67
HincII GTYRAC 1 cut(s) 7
HindII GTYRAC 1 cut(s) 7
HinfI GANTC 2 cut(s) 152, 175
Hpy166II GTNNAC 1 cut(s) 7
Hpy188I TCNGA 3 cut(s) 72, 116, 195
Hpy8I GTNNAC 1 cut(s) 7
HpyCH4V TGCA 1 cut(s) 181
HpyF10VI GCNNNNNNNGC 1 cut(s) 73
HpyF3I CTNAG 4 cut(s) 69, 77, 83, 98
LmnI GCTCC 1 cut(s) 54
LpnPI CCDG 2 cut(s) 126, 153
MboII GAAGA 2 cut(s) 47, 50
MluCI AATT 2 cut(s) 15, 105
MnlI CCTC 3 cut(s) 57, 66, 78
MseI TTAA 1 cut(s) 162
MspCI CTTAAG 1 cut(s) 161
MwoI GCNNNNNNNGC 1 cut(s) 73
PceI AGGCCT 1 cut(s) 67
PfeI GAWTC 2 cut(s) 152, 175
PstNI CAGNNNCTG 1 cut(s) 76
RsaI GTAC 1 cut(s) 47
RsaNI GTAC 1 cut(s) 46
SaqAI TTAA 1 cut(s) 162
SetI ASST 1 cut(s) 59
SgeI CNNG 7 cut(s) 22, 73, 102, 144, 153, 168, 180
SmlI CTYRAG 1 cut(s) 161
SmoI CTYRAG 1 cut(s) 161
Sse9I AATT 2 cut(s) 15, 105
SseBI AGGCCT 1 cut(s) 67
StuI AGGCCT 1 cut(s) 67
TasI AATT 2 cut(s) 15, 105
TfiI GAWTC 2 cut(s) 152, 175
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TspGWI ACGGA 2 cut(s) 63, 67
Vha464I CTTAAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.