FvH4_1g18120

disease resistance

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Reverse (-)
10528439 .. 10528825
387 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g18120.t1

Sequence Viewer

Length: 267 bp
ATGGAGGAGATAGTATCCGTACAAGAAGATGATGAAGAGAACAATATGGATAACATTTTTTCTAAGATAAAATCTCTGACATTAGAAAAGCTTCCAAGCTTGGTTAGATTGTATGCAGGAAGTCATGCTGAATTTTCATCATTAGAGGAGGTATTCAACCTAGGTGCTGACAATGTTGTACCTTGCTATCTTTTCGACAAAAAGGTAACATTTCCTAGCTTGGAGACGTTAAGGCTCCGTAAGCTACCTAAGTTGAAGGCAGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

10.03

Weight (kDa)

4.93

Isoelectric Point (pI)

45.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023990)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18120
rosa_samantha Rh2AG203800 Rh2AG204100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 131
AfaI GTAC 2 cut(s) 21, 180
AgsI TTSAA 2 cut(s) 157, 256
AluBI AGCT 4 cut(s) 91, 99, 219, 244
AluI AGCT 4 cut(s) 91, 99, 219, 244
Alw26I GTCTC 1 cut(s) 218
ApoI RAATTY 1 cut(s) 131
Asp700I GAANNNNTTC 1 cut(s) 90
AspA2I CCTAGG 1 cut(s) 160
AvrII CCTAGG 1 cut(s) 160
BciVI GTATCC 1 cut(s) 25
BcoDI GTCTC 1 cut(s) 218
BfaI CTAG 2 cut(s) 161, 216
BfuI GTATCC 1 cut(s) 25
BlnI CCTAGG 1 cut(s) 160
BmiI GGNNCC 1 cut(s) 236
BsaJI CCNNGG 1 cut(s) 160
BseDI CCNNGG 1 cut(s) 160
BseRI GAGGAG 2 cut(s) 20, 161
BsmAI GTCTC 1 cut(s) 218
BsmBI CGTCTC 1 cut(s) 218
BspLI GGNNCC 1 cut(s) 236
BssECI CCNNGG 1 cut(s) 160
BssT1I CCWWGG 1 cut(s) 160
Bst6I CTCTTC 1 cut(s) 30
BstDEI CTNAG 2 cut(s) 63, 249
BstMAI GTCTC 1 cut(s) 218
BstMWI GCNNNNNNNGC 1 cut(s) 241
BsuI GTATCC 1 cut(s) 25
Csp6I GTAC 2 cut(s) 20, 179
CviAII CATG 1 cut(s) 125
CviJI RGCY 5 cut(s) 91, 99, 219, 235, 244
CviKI_1 RGCY 5 cut(s) 91, 99, 219, 235, 244
CviQI GTAC 2 cut(s) 20, 179
DdeI CTNAG 2 cut(s) 63, 249
Eam1104I CTCTTC 1 cut(s) 30
EarI CTCTTC 1 cut(s) 30
Eco130I CCWWGG 1 cut(s) 160
EcoT14I CCWWGG 1 cut(s) 160
ErhI CCWWGG 1 cut(s) 160
Esp3I CGTCTC 1 cut(s) 218
FaeI CATG 1 cut(s) 128
FaiI YATR 4 cut(s) 47, 114, 126, 265
FatI CATG 1 cut(s) 124
FspBI CTAG 2 cut(s) 161, 216
Hin1II CATG 1 cut(s) 128
HindIII AAGCTT 2 cut(s) 89, 97
Hpy188I TCNGA 1 cut(s) 78
HpyAV CCTTC 1 cut(s) 250
HpyCH4IV ACGT 1 cut(s) 227
HpyCH4V TGCA 1 cut(s) 116
HpyF10VI GCNNNNNNNGC 1 cut(s) 241
HpyF3I CTNAG 2 cut(s) 63, 249
HpySE526I ACGT 1 cut(s) 227
Hsp92II CATG 1 cut(s) 128
LmnI GCTCC 1 cut(s) 240
LpnPI CCDG 1 cut(s) 102
MaeI CTAG 2 cut(s) 161, 216
MaeII ACGT 1 cut(s) 227
MaeIII GTNAC 1 cut(s) 205
MboII GAAGA 2 cut(s) 38, 47
MluCI AATT 1 cut(s) 131
MnlI CCTC 2 cut(s) 139, 142
MroXI GAANNNNTTC 1 cut(s) 90
MseI TTAA 1 cut(s) 230
MwoI GCNNNNNNNGC 1 cut(s) 241
NlaIII CATG 1 cut(s) 128
NlaIV GGNNCC 1 cut(s) 236
PdmI GAANNNNTTC 1 cut(s) 90
PspN4I GGNNCC 1 cut(s) 236
RsaI GTAC 2 cut(s) 21, 180
RsaNI GTAC 2 cut(s) 20, 179
SaqAI TTAA 1 cut(s) 230
SgeI CNNG 9 cut(s) 35, 108, 112, 129, 137, 173, 195, 228, 232
Sse9I AATT 1 cut(s) 131
SspMI CTAG 2 cut(s) 161, 216
StyI CCWWGG 1 cut(s) 160
TaiI ACGT 1 cut(s) 230
TaqI TCGA 1 cut(s) 195
TasI AATT 1 cut(s) 131
Tru1I TTAA 1 cut(s) 230
Tru9I TTAA 1 cut(s) 230
TspDTI ATGAA 2 cut(s) 48, 126
TspGWI ACGGA 2 cut(s) 7, 227
XapI RAATTY 1 cut(s) 131
XmaJI CCTAGG 1 cut(s) 160
XmnI GAANNNNTTC 1 cut(s) 90
XspI CTAG 2 cut(s) 161, 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.