Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb3

Orthogroup ID

OG0021032

Physical Location & Seq

Genomic Coordinates Reverse (-)

1393775 .. 1394278

Gene Structure 504 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_3g02750.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 198 bp

ATGCTCTGTATAATGGTAAATGCTCTGTTTTACCATTTTAAGCATTTATCTTTCAGTTCTTCTGTCCATCCCAAGATGCTGAATGCTAGGATAGGGAACTGTGTGGAGATTGGTGCAAATACATGCATCGACATGCAGGGGAAGTTGGAGATATACCGTTGTATAGGAGATCATTCTAAGATTGATAATTTAGTTCAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0006040 GO:0006793 GO:0006796 GO:0008150 GO:0008152 GO:0009987 GO:0016740 GO:0016746 GO:0016747 GO:0019637 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043764 GO:0044237 GO:0044424 GO:0044444 GO:0044464 GO:0071704 GO:1901135 GO:2001289

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Hexapep

Protein Analysis

66

Amino Acids

7.47

Weight (kDa)

7.72

Isoelectric Point (pI)

15.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021032)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g02750
rosa_multiflora	Rmu_sc0000547.1_g000006 Rmu_sc0021254.1_g000001
rosa_samantha	Rh5AG035800 Rh5CG038500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
BccI	CCATC	1 cut(s)	75
BfaI	CTAG	1 cut(s)	87
BmsI	GCATC	2 cut(s)	66, 135
BseGI	GGATG	1 cut(s)	67
BsmI	GAATGC	1 cut(s)	88
Bsp143I	GATC	1 cut(s)	169
BssMI	GATC	1 cut(s)	169
Bst4CI	ACNGT	2 cut(s)	101, 158
BstDEI	CTNAG	1 cut(s)	177
BstF5I	GGATG	1 cut(s)	67
BstKTI	GATC	1 cut(s)	172
BstMBI	GATC	1 cut(s)	169
BstNSI	RCATGY	2 cut(s)	126, 136
BtsCI	GGATG	1 cut(s)	67
CviAII	CATG	2 cut(s)	123, 133
DdeI	CTNAG	1 cut(s)	177
DpnI	GATC	1 cut(s)	171
DpnII	GATC	1 cut(s)	169
EcoT22I	ATGCAT	1 cut(s)	128
FaeI	CATG	2 cut(s)	126, 136
FaiI	YATR	5 cut(s)	11, 124, 134, 154, 164
FatI	CATG	2 cut(s)	122, 132
FokI	GGATG	1 cut(s)	54
FspBI	CTAG	1 cut(s)	87
Hin1II	CATG	2 cut(s)	126, 136
HpyCH4III	ACNGT	2 cut(s)	101, 158
HpyCH4V	TGCA	3 cut(s)	116, 126, 136
HpyF3I	CTNAG	1 cut(s)	177
Hsp92II	CATG	2 cut(s)	126, 136
Kzo9I	GATC	1 cut(s)	169
LpnPI	CCDG	1 cut(s)	122
LweI	GCATC	2 cut(s)	66, 135
MaeI	CTAG	1 cut(s)	87
MalI	GATC	1 cut(s)	171
MboI	GATC	1 cut(s)	169
MboII	GAAGA	1 cut(s)	51
MluCI	AATT	1 cut(s)	187
MmeI	TCCRAC	1 cut(s)	126
Mph1103I	ATGCAT	1 cut(s)	128
MseI	TTAA	1 cut(s)	39
MslI	CAYNNNNRTG	1 cut(s)	131
Mva1269I	GAATGC	1 cut(s)	88
NdeII	GATC	1 cut(s)	169
NlaIII	CATG	2 cut(s)	126, 136
NsiI	ATGCAT	1 cut(s)	128
NspI	RCATGY	2 cut(s)	126, 136
PctI	GAATGC	1 cut(s)	88
RseI	CAYNNNNRTG	1 cut(s)	131
SaqAI	TTAA	1 cut(s)	39
Sau3AI	GATC	1 cut(s)	169
SfaNI	GCATC	2 cut(s)	66, 135
SgeI	CNNG	5 cut(s)	85, 99, 135, 145, 149
SmiMI	CAYNNNNRTG	1 cut(s)	131
Sse9I	AATT	1 cut(s)	187
SspMI	CTAG	1 cut(s)	87
TaaI	ACNGT	2 cut(s)	101, 158
TaqI	TCGA	1 cut(s)	129
TasI	AATT	1 cut(s)	187
Tru1I	TTAA	1 cut(s)	39
Tru9I	TTAA	1 cut(s)	39
XceI	RCATGY	2 cut(s)	126, 136
XspI	CTAG	1 cut(s)	87
Zsp2I	ATGCAT	1 cut(s)	128

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.