FvH4_3g03435

G-type lectin S-receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
OG0022176
Physical Location & Seq
Reverse (-)
1875960 .. 1876356
397 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g03435.t1

Sequence Viewer

Length: 324 bp
ATGGGAGCTGAGTTGTGGCAGACTTTTGATTATCCTACTGACACACTTCTGCCAAATATGATGCTGGGATTTGATAGTAATACTGGAAACTGGAATTTGTTGACATCATGGAAAGGTGGAAATGATCCATCAACTGGGATATTCTCAGTTGTATTGTCAGAACAGATGCCAACACAAGCGTTCATTTGGAAAAATGGATCAACTCCCCACTGGAGAAGTGGTCCATGGGATAAATCAAAATTTGTAGGTGTACCTGGAATGGATACTGAATATCTAAGTGGATTCACTCTAAATGATAATTTCAAACAGGGAACAAGATTATGA

Protein Analysis

108

Amino Acids

12.01

Weight (kDa)

4.79

Isoelectric Point (pI)

23.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B_lectin PF01453 4 - 38 4.8e-10 D-mannose binding lectin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022176)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g03435
rosa_chinensis RchiOBHm_Chr5g0005591
rosa_samantha Rh5CG051400
rosa_wichuraiana Rw5G004360

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 134
AclWI GGATC 2 cut(s) 119, 205
AcsI RAATTY 2 cut(s) 94, 239
AfaI GTAC 1 cut(s) 252
AfiI CCNNNNNNNGG 1 cut(s) 134
AgsI TTSAA 1 cut(s) 304
AjnI CCWGG 1 cut(s) 253
AluBI AGCT 1 cut(s) 8
AluI AGCT 1 cut(s) 8
AlwI GGATC 2 cut(s) 119, 205
ApoI RAATTY 2 cut(s) 94, 239
AspS9I GGNCC 1 cut(s) 221
AvaII GGWCC 1 cut(s) 221
BccI CCATC 1 cut(s) 136
BciT130I CCWGG 1 cut(s) 255
BciVI GTATCC 1 cut(s) 256
BfuI GTATCC 1 cut(s) 256
Bme1390I CCNGG 1 cut(s) 255
Bme18I GGWCC 1 cut(s) 221
BmgT120I GGNCC 1 cut(s) 221
BmrFI CCNGG 1 cut(s) 255
BmrI ACTGGG 1 cut(s) 144
BmsI GCATC 2 cut(s) 51, 156
BmuI ACTGGG 1 cut(s) 144
BpmI CTGGAG 1 cut(s) 232
BsaJI CCNNGG 1 cut(s) 224
BsaXI ACNNNNNCTCC 2 cut(s) 205, 235
Bsc4I CCNNNNNNNGG 1 cut(s) 134
Bse1I ACTGG 4 cut(s) 88, 95, 139, 215
BseBI CCWGG 1 cut(s) 255
BseDI CCNNGG 1 cut(s) 224
BseLI CCNNNNNNNGG 1 cut(s) 134
BseMII CTCAG 1 cut(s) 159
BseNI ACTGG 4 cut(s) 88, 95, 139, 215
BseYI CCCAGC 1 cut(s) 64
BslI CCNNNNNNNGG 1 cut(s) 134
Bsp143I GATC 2 cut(s) 124, 197
Bsp19I CCATGG 1 cut(s) 224
BspCNI CTCAG 1 cut(s) 158
BspPI GGATC 2 cut(s) 119, 205
BsrI ACTGG 4 cut(s) 88, 95, 139, 215
BssECI CCNNGG 1 cut(s) 224
BssMI GATC 2 cut(s) 124, 197
BssT1I CCWWGG 1 cut(s) 224
Bst2UI CCWGG 1 cut(s) 255
BstDEI CTNAG 3 cut(s) 9, 145, 275
BstDSI CCRYGG 1 cut(s) 224
BstKTI GATC 2 cut(s) 127, 200
BstMBI GATC 2 cut(s) 124, 197
BstNI CCWGG 1 cut(s) 255
BstSCI CCNGG 1 cut(s) 253
BsuI GTATCC 1 cut(s) 256
BtgI CCRYGG 1 cut(s) 224
BtsIMutI CAGTG 1 cut(s) 208
Cfr13I GGNCC 1 cut(s) 221
Csp6I GTAC 1 cut(s) 251
CviAII CATG 2 cut(s) 108, 225
CviJI RGCY 1 cut(s) 8
CviKI_1 RGCY 1 cut(s) 8
CviQI GTAC 1 cut(s) 251
DdeI CTNAG 3 cut(s) 9, 145, 275
DpnI GATC 2 cut(s) 126, 199
DpnII GATC 2 cut(s) 124, 197
Eco130I CCWWGG 1 cut(s) 224
Eco47I GGWCC 1 cut(s) 221
EcoRII CCWGG 1 cut(s) 253
EcoT14I CCWWGG 1 cut(s) 224
ErhI CCWWGG 1 cut(s) 224
FaeI CATG 2 cut(s) 111, 228
FaiI YATR 4 cut(s) 59, 109, 226, 322
FatI CATG 2 cut(s) 107, 224
GsaI CCCAGC 1 cut(s) 68
GsuI CTGGAG 1 cut(s) 232
Hin1II CATG 2 cut(s) 111, 228
HincII GTYRAC 1 cut(s) 102
HindII GTYRAC 1 cut(s) 102
HinfI GANTC 1 cut(s) 282
Hpy166II GTNNAC 2 cut(s) 102, 251
Hpy188I TCNGA 1 cut(s) 160
Hpy8I GTNNAC 2 cut(s) 102, 251
HpyF3I CTNAG 3 cut(s) 9, 145, 275
Hsp92II CATG 2 cut(s) 111, 228
Kzo9I GATC 2 cut(s) 124, 197
LmnI GCTCC 1 cut(s) 5
LpnPI CCDG 8 cut(s) 50, 69, 76, 120, 196, 240, 267, 293
LweI GCATC 2 cut(s) 51, 156
MalI GATC 2 cut(s) 126, 199
MboI GATC 2 cut(s) 124, 197
MluCI AATT 3 cut(s) 94, 239, 298
MspR9I CCNGG 1 cut(s) 255
MvaI CCWGG 1 cut(s) 255
NcoI CCATGG 1 cut(s) 224
NdeII GATC 2 cut(s) 124, 197
NlaIII CATG 2 cut(s) 111, 228
PfeI GAWTC 1 cut(s) 282
PflMI CCANNNNNTGG 1 cut(s) 134
Psp6I CCWGG 1 cut(s) 253
PspFI CCCAGC 1 cut(s) 64
PspGI CCWGG 1 cut(s) 253
PspPI GGNCC 1 cut(s) 221
RsaI GTAC 1 cut(s) 252
RsaNI GTAC 1 cut(s) 251
Sau3AI GATC 2 cut(s) 124, 197
Sau96I GGNCC 1 cut(s) 221
ScrFI CCNGG 1 cut(s) 255
SetI ASST 4 cut(s) 10, 118, 250, 256
SfaNI GCATC 2 cut(s) 51, 156
SinI GGWCC 1 cut(s) 221
Sse9I AATT 3 cut(s) 94, 239, 298
StyD4I CCNGG 1 cut(s) 253
StyI CCWWGG 1 cut(s) 224
TasI AATT 3 cut(s) 94, 239, 298
TfiI GAWTC 1 cut(s) 282
TscAI CASTG 1 cut(s) 215
TspDTI ATGAA 1 cut(s) 172
TspRI CASTG 1 cut(s) 215
Van91I CCANNNNNTGG 1 cut(s) 134
VpaK11BI GGWCC 1 cut(s) 221
XapI RAATTY 2 cut(s) 94, 239
XcmI CCANNNNNNNNNTGG 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.