Rw5G004360

PAN-like domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0022176
Physical Location & Seq
Reverse (-)
4545378 .. 4547165
1788 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G004360.1

Sequence Viewer

Length: 447 bp
ATGCTGCCTAACATGGTGCTGGGTTACAATAGAAAATCTGGAAAGAGCAGTATCTTGACAGCCTGGAAAAATGAGAATGATCCATCCACTGGGATATTCTCGGCTGCAGGTGGATTGGTAAAGGAGATACCAGGACAAGCACAACAGAATCCATGTGACATCTATGGAGCATGTGGACCTTTTGGGGTTTGCAATAATGCTTCTGCATCTCCAATCTGCAGGTTGTTGTCAAAAGACCTTATTGATATACAGGAGGTTCCCTCTGGCAGAGCAGATCTTTTTATCTGCCTAGCCCACTCAGGTGATATGGAAAACCAAATAAAGTTAACTGCCAGCCTTGCAGCTATTTGTTTTATCAGTATCTTGGCTGTCATACCGTTAGGTTTGCATAGGTTGCGAGCTAACCAAATTGGAGGCATCCTCAAGGCAAGGGACTTGACTTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B_lectin PAN_2 Pkinase_Tyr S_locus_glycop

Protein Analysis

148

Amino Acids

15.68

Weight (kDa)

8.25

Isoelectric Point (pI)

27.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022176)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g03435
rosa_chinensis RchiOBHm_Chr5g0005591
rosa_samantha Rh5CG051400
rosa_wichuraiana Rw5G004360

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 98
Acc36I ACCTGC 2 cut(s) 98, 210
AccB7I CCANNNNNTGG 1 cut(s) 89
AclWI GGATC 1 cut(s) 74
AfiI CCNNNNNNNGG 1 cut(s) 89
AjnI CCWGG 2 cut(s) 62, 130
AleI CACNNNNGTG 1 cut(s) 300
AluBI AGCT 2 cut(s) 344, 401
AluI AGCT 2 cut(s) 344, 401
AlwI GGATC 1 cut(s) 74
ApeKI GCWGC 3 cut(s) 4, 104, 341
AspS9I GGNCC 1 cut(s) 176
AsuHPI GGTGA 1 cut(s) 314
AvaII GGWCC 1 cut(s) 176
BbvI GCAGC 2 cut(s) 91, 353
BccI CCATC 1 cut(s) 91
BciT130I CCWGG 2 cut(s) 64, 132
BfaI CTAG 1 cut(s) 290
BfmI CTRYAG 2 cut(s) 105, 217
BfuAI ACCTGC 2 cut(s) 98, 210
BglII AGATCT 1 cut(s) 274
BisI GCNGC 3 cut(s) 5, 105, 342
BlsI GCNGC 3 cut(s) 6, 106, 343
Bme1390I CCNGG 2 cut(s) 64, 132
Bme18I GGWCC 1 cut(s) 176
BmgT120I GGNCC 1 cut(s) 176
BmiI GGNNCC 1 cut(s) 258
BmrFI CCNGG 2 cut(s) 64, 132
BmrI ACTGGG 1 cut(s) 99
BmsI GCATC 2 cut(s) 215, 426
BmuI ACTGGG 1 cut(s) 99
BplI GAGNNNNNCTC 4 cut(s) 245, 277, 405, 437
BpuEI CTTGAG 1 cut(s) 407
Bsc4I CCNNNNNNNGG 1 cut(s) 89
Bse1I ACTGG 1 cut(s) 94
BseBI CCWGG 2 cut(s) 64, 132
BseGI GGATG 2 cut(s) 83, 417
BseLI CCNNNNNNNGG 1 cut(s) 89
BseMII CTCAG 1 cut(s) 312
BseNI ACTGG 1 cut(s) 94
BseXI GCAGC 2 cut(s) 91, 353
BseYI CCCAGC 1 cut(s) 19
BslI CCNNNNNNNGG 1 cut(s) 89
Bsp143I GATC 2 cut(s) 79, 274
BspCNI CTCAG 1 cut(s) 311
BspLI GGNNCC 1 cut(s) 258
BspMAI CTGCAG 2 cut(s) 109, 221
BspMI ACCTGC 2 cut(s) 98, 210
BspPI GGATC 1 cut(s) 74
BsrI ACTGG 1 cut(s) 94
BssMI GATC 2 cut(s) 79, 274
Bst2UI CCWGG 2 cut(s) 64, 132
Bst4CI ACNGT 1 cut(s) 378
BstAPI GCANNNNNTGC 1 cut(s) 394
BstC8I GCNNGC 2 cut(s) 334, 399
BstDEI CTNAG 1 cut(s) 298
BstF5I GGATG 2 cut(s) 83, 417
BstKTI GATC 2 cut(s) 82, 277
BstMBI GATC 2 cut(s) 79, 274
BstMWI GCNNNNNNNGC 2 cut(s) 338, 394
BstNI CCWGG 2 cut(s) 64, 132
BstNSI RCATGY 1 cut(s) 174
BstSCI CCNGG 2 cut(s) 62, 130
BstSFI CTRYAG 2 cut(s) 105, 217
BstV1I GCAGC 2 cut(s) 91, 353
BstX2I RGATCY 1 cut(s) 274
BstYI RGATCY 1 cut(s) 274
BtsCI GGATG 2 cut(s) 83, 417
BtsIMutI CAGTG 1 cut(s) 87
BveI ACCTGC 2 cut(s) 98, 210
Cac8I GCNNGC 2 cut(s) 334, 399
Cfr13I GGNCC 1 cut(s) 176
CviAII CATG 3 cut(s) 13, 153, 171
CviJI RGCY 7 cut(s) 62, 104, 293, 336, 344, 368, 401
CviKI_1 RGCY 7 cut(s) 62, 104, 293, 336, 344, 368, 401
DdeI CTNAG 1 cut(s) 298
DpnI GATC 2 cut(s) 81, 276
DpnII GATC 2 cut(s) 79, 274
Eco47I GGWCC 1 cut(s) 176
EcoRII CCWGG 2 cut(s) 62, 130
FaeI CATG 3 cut(s) 16, 156, 174
FaiI YATR 8 cut(s) 14, 154, 165, 172, 248, 308, 374, 390
FatI CATG 3 cut(s) 12, 152, 170
Fnu4HI GCNGC 3 cut(s) 5, 105, 342
FokI GGATG 2 cut(s) 70, 404
Fsp4HI GCNGC 3 cut(s) 5, 105, 342
FspBI CTAG 1 cut(s) 290
GluI GCNGC 3 cut(s) 5, 105, 342
GsaI CCCAGC 1 cut(s) 23
Hin1II CATG 3 cut(s) 16, 156, 174
HincII GTYRAC 1 cut(s) 327
HindII GTYRAC 1 cut(s) 327
HinfI GANTC 1 cut(s) 148
HpaI GTTAAC 1 cut(s) 327
HphI GGTGA 1 cut(s) 314
Hpy166II GTNNAC 2 cut(s) 176, 327
Hpy188III TCNNGA 2 cut(s) 39, 55
Hpy8I GTNNAC 2 cut(s) 176, 327
HpyCH4III ACNGT 1 cut(s) 378
HpyCH4V TGCA 6 cut(s) 107, 192, 206, 219, 341, 388
HpyF10VI GCNNNNNNNGC 2 cut(s) 338, 394
HpyF3I CTNAG 1 cut(s) 298
Hsp92II CATG 3 cut(s) 16, 156, 174
KspAI GTTAAC 1 cut(s) 327
Kzo9I GATC 2 cut(s) 79, 274
LmnI GCTCC 1 cut(s) 167
Lsp1109I GCAGC 2 cut(s) 91, 353
LweI GCATC 2 cut(s) 215, 426
MaeI CTAG 1 cut(s) 290
MaeIII GTNAC 2 cut(s) 23, 155
MalI GATC 2 cut(s) 81, 276
MboI GATC 2 cut(s) 79, 274
MflI RGATCY 1 cut(s) 274
MluCI AATT 1 cut(s) 408
MnlI CCTC 4 cut(s) 247, 271, 407, 431
MseI TTAA 1 cut(s) 326
MslI CAYNNNNRTG 1 cut(s) 300
MspR9I CCNGG 2 cut(s) 64, 132
MvaI CCWGG 2 cut(s) 64, 132
MwoI GCNNNNNNNGC 2 cut(s) 338, 394
NdeII GATC 2 cut(s) 79, 274
NlaIII CATG 3 cut(s) 16, 156, 174
NlaIV GGNNCC 1 cut(s) 258
NmeAIII GCCGAG 1 cut(s) 80
NmuCI GTSAC 1 cut(s) 155
NspI RCATGY 1 cut(s) 174
OliI CACNNNNGTG 1 cut(s) 300
PaqCI CACCTGC 1 cut(s) 98
PfeI GAWTC 1 cut(s) 148
PflMI CCANNNNNTGG 1 cut(s) 89
PkrI GCNGC 3 cut(s) 6, 106, 343
Psp6I CCWGG 2 cut(s) 62, 130
PspFI CCCAGC 1 cut(s) 19
PspGI CCWGG 2 cut(s) 62, 130
PspN4I GGNNCC 1 cut(s) 258
PspPI GGNCC 1 cut(s) 176
PstI CTGCAG 2 cut(s) 109, 221
PsuI RGATCY 1 cut(s) 274
RseI CAYNNNNRTG 1 cut(s) 300
SaqAI TTAA 1 cut(s) 326
SatI GCNGC 3 cut(s) 5, 105, 342
Sau3AI GATC 2 cut(s) 79, 274
Sau96I GGNCC 1 cut(s) 176
ScrFI CCNGG 2 cut(s) 64, 132
SfaNI GCATC 2 cut(s) 215, 426
SfcI CTRYAG 2 cut(s) 105, 217
SinI GGWCC 1 cut(s) 176
SmiMI CAYNNNNRTG 1 cut(s) 300
SmlI CTYRAG 1 cut(s) 422
SmoI CTYRAG 1 cut(s) 422
Sse9I AATT 1 cut(s) 408
SspMI CTAG 1 cut(s) 290
StyD4I CCNGG 2 cut(s) 62, 130
TaaI ACNGT 1 cut(s) 378
TasI AATT 1 cut(s) 408
TfiI GAWTC 1 cut(s) 148
Tru1I TTAA 1 cut(s) 326
Tru9I TTAA 1 cut(s) 326
TscAI CASTG 1 cut(s) 94
TseFI GTSAC 1 cut(s) 155
TseI GCWGC 3 cut(s) 4, 104, 341
Tsp45I GTSAC 1 cut(s) 155
TspRI CASTG 1 cut(s) 94
Van91I CCANNNNNTGG 1 cut(s) 89
VpaK11BI GGWCC 1 cut(s) 176
XceI RCATGY 1 cut(s) 174
XspI CTAG 1 cut(s) 290
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.