FvH4_3g17320

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Forward (+)
11032601 .. 11033558
958 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g17320.t1

Sequence Viewer

Length: 294 bp
ATGGCAGGACTCATTAACAAGATCGGAGATGCGCTCCACATCGGAGGAGGAGGAGGAGGAGGAAACGACGAGAAGCACAACAAGAAAGAGGAGGGGGAGCACCACAAGAAAGGGGATGATCACTACAAGGGCAAGGACAAGGACGACGACCATAAGAAACACAAGGACGACGACCATAGCAAGAGCAAGGACCACCACGACGATCACCACAAGGACGACAAGAAGAAGAAGAAGAAGAACAAGGACAAGAAGAAGGACGACGGCCACAGCAGCAGCAGCAGCGACAGCGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

10.84

Weight (kDa)

7.25

Isoelectric Point (pI)

52.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019175)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G54410
fragaria_vesca FvH4_3g17320
malus_domestica MD14G1005700.v1.1
prunus_persica Prupe.7G009800_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0496451
rosa_rugosa Rorug03G0283000
rosa_samantha Rh3BG364900
rosa_wichuraiana Rw3G028790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 262
Alw21I GWGCWC 1 cut(s) 102
AoxI GGCC 1 cut(s) 262
ApeKI GCWGC 4 cut(s) 270, 273, 276, 279
AspLEI GCGC 1 cut(s) 34
AspS9I GGNCC 1 cut(s) 190
AsuHPI GGTGA 1 cut(s) 197
AvaII GGWCC 1 cut(s) 190
Bbv12I GWGCWC 1 cut(s) 102
BbvI GCAGC 3 cut(s) 282, 285, 288
BceAI ACGGC 1 cut(s) 277
BclI TGATCA 1 cut(s) 118
BisI GCNGC 4 cut(s) 271, 274, 277, 280
BlsI GCNGC 4 cut(s) 272, 275, 278, 281
Bme18I GGWCC 1 cut(s) 190
BmgT120I GGNCC 1 cut(s) 190
BmsI GCATC 1 cut(s) 19
BplI GAGNNNNNCTC 2 cut(s) 18, 50
BseGI GGATG 1 cut(s) 121
BseRI GAGGAG 6 cut(s) 60, 63, 66, 69, 72, 104
BseXI GCAGC 3 cut(s) 282, 285, 288
BshFI GGCC 1 cut(s) 264
BsiHKAI GWGCWC 1 cut(s) 102
BsnI GGCC 1 cut(s) 264
Bsp1286I GDGCHC 1 cut(s) 102
Bsp143I GATC 3 cut(s) 21, 118, 202
BspANI GGCC 1 cut(s) 264
BssMI GATC 3 cut(s) 21, 118, 202
BstF5I GGATG 1 cut(s) 121
BstHHI GCGC 1 cut(s) 34
BstKTI GATC 3 cut(s) 24, 121, 205
BstMBI GATC 3 cut(s) 21, 118, 202
BstMWI GCNNNNNNNGC 4 cut(s) 270, 276, 279, 285
BstV1I GCAGC 3 cut(s) 282, 285, 288
BsuRI GGCC 1 cut(s) 264
BtsCI GGATG 1 cut(s) 121
CfoI GCGC 1 cut(s) 34
Cfr13I GGNCC 1 cut(s) 190
CviJI RGCY 1 cut(s) 264
CviKI_1 RGCY 1 cut(s) 264
DpnI GATC 3 cut(s) 23, 120, 204
DpnII GATC 3 cut(s) 21, 118, 202
EaeI YGGCCR 1 cut(s) 262
Eco47I GGWCC 1 cut(s) 190
FaiI YATR 2 cut(s) 153, 177
FbaI TGATCA 1 cut(s) 118
Fnu4HI GCNGC 4 cut(s) 271, 274, 277, 280
FokI GGATG 1 cut(s) 128
Fsp4HI GCNGC 4 cut(s) 271, 274, 277, 280
GlaI GCGC 1 cut(s) 33
GluI GCNGC 4 cut(s) 271, 274, 277, 280
HaeIII GGCC 1 cut(s) 264
HhaI GCGC 1 cut(s) 34
Hin6I GCGC 1 cut(s) 32
HinP1I GCGC 1 cut(s) 32
HinfI GANTC 1 cut(s) 9
HphI GGTGA 1 cut(s) 197
Hpy188I TCNGA 2 cut(s) 26, 44
Hpy99I CGWCG 5 cut(s) 71, 149, 173, 203, 263
HpyAV CCTTC 1 cut(s) 247
HpyF10VI GCNNNNNNNGC 4 cut(s) 270, 276, 279, 285
HspAI GCGC 1 cut(s) 32
Ksp22I TGATCA 1 cut(s) 118
Kzo9I GATC 3 cut(s) 21, 118, 202
LmnI GCTCC 2 cut(s) 39, 97
Lsp1109I GCAGC 3 cut(s) 282, 285, 288
LweI GCATC 1 cut(s) 19
MalI GATC 3 cut(s) 23, 120, 204
MboI GATC 3 cut(s) 21, 118, 202
MboII GAAGA 6 cut(s) 235, 238, 241, 244, 247, 262
MhlI GDGCHC 1 cut(s) 102
MlyI GAGTC 1 cut(s) 3
MnlI CCTC 8 cut(s) 38, 41, 44, 47, 50, 53, 82, 85
MseI TTAA 1 cut(s) 15
MwoI GCNNNNNNNGC 4 cut(s) 270, 276, 279, 285
NdeII GATC 3 cut(s) 21, 118, 202
PkrI GCNGC 4 cut(s) 272, 275, 278, 281
PleI GAGTC 1 cut(s) 3
PpsI GAGTC 1 cut(s) 3
PspPI GGNCC 1 cut(s) 190
SaqAI TTAA 1 cut(s) 15
SatI GCNGC 4 cut(s) 271, 274, 277, 280
Sau3AI GATC 3 cut(s) 21, 118, 202
Sau96I GGNCC 1 cut(s) 190
SchI GAGTC 1 cut(s) 3
SduI GDGCHC 1 cut(s) 102
SfaNI GCATC 1 cut(s) 19
SinI GGWCC 1 cut(s) 190
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TseI GCWGC 4 cut(s) 270, 273, 276, 279
VpaK11BI GGWCC 1 cut(s) 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.