FvH4_3g26082

Belongs to the RNase T2 family

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Reverse (-)
18935609 .. 18936226
618 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g26082.t1

Sequence Viewer

Length: 489 bp
ATGCGTACTAGACCCTTGACTCCTAGAGTTCAAGCTGAAAAGAAACCCCCAGAGGCGAAACCTTTCAAGATTAAAAAATATAACGGTAACGGGTGCCCATACCTTCATCTAGAGCTTTTCCAGTCACAACTAGATTCCACCCGCTACACAGATGCCCAAGCTTGTCATGCCTTCCGAGAAACACTGTCAAAAGAAGCATTGAGTTGGTTCTTACGACTCCCGCCAAATTCAGTTGATGGCTGTGAACAGCTCAGTCAAAAATTTAACCTAGATGAAGCTGTAGCAATAGTGGCTTTCCTCCAAGCTCTCAGGCCAACACATTTTGTAGTGGAATTAAACAAGAGGAGCTTCAAATGTTATGATGATCTGATTGCAGAGGTGACACGGCAAGCTCAAGCTGAATATGATACATTTGTGGAAAGGAAAGGCAATGCCACCCCTTCTCAATTCCAAACTCGGGGTCATCGGGAAAAGTGGGAATCGGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

163

Amino Acids

18.74

Weight (kDa)

8.9

Isoelectric Point (pI)

36.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g26082
pyrus_communis pycom01g06370 pycom02g18840 pycom15g08660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 93
AciI CCGC 2 cut(s) 142, 221
AcsI RAATTY 2 cut(s) 226, 260
AfaI GTAC 1 cut(s) 7
AfiI CCNNNNNNNGG 1 cut(s) 457
AgsI TTSAA 3 cut(s) 32, 67, 352
AluBI AGCT 9 cut(s) 35, 115, 161, 250, 278, 305, 348, 392, 398
AluI AGCT 9 cut(s) 35, 115, 161, 250, 278, 305, 348, 392, 398
Ama87I CYCGRG 1 cut(s) 456
AoxI GGCC 1 cut(s) 311
ApoI RAATTY 2 cut(s) 226, 260
ArsI GACNNNNNNTTYG 2 cut(s) 445, 477
Asp700I GAANNNNTTC 1 cut(s) 62
AsuHPI GGTGA 1 cut(s) 391
AvaI CYCGRG 1 cut(s) 456
BaeGI GKGCMC 1 cut(s) 98
BaeI ACNNNNGTAYC 2 cut(s) 399, 432
BanI GGYRCC 1 cut(s) 93
BccI CCATC 1 cut(s) 230
BceAI ACGGC 1 cut(s) 401
BfaI CTAG 5 cut(s) 9, 24, 110, 131, 269
BfmI CTRYAG 1 cut(s) 279
BmeT110I CYCGRG 1 cut(s) 456
BmiI GGNNCC 1 cut(s) 95
BmsI GCATC 1 cut(s) 142
BpuEI CTTGAG 1 cut(s) 378
Bsc4I CCNNNNNNNGG 1 cut(s) 457
Bse1I ACTGG 1 cut(s) 121
Bse3DI GCAATG 1 cut(s) 436
BseLI CCNNNNNNNGG 1 cut(s) 457
BseMI GCAATG 1 cut(s) 436
BseMII CTCAG 2 cut(s) 265, 322
BseNI ACTGG 1 cut(s) 121
BseRI GAGGAG 1 cut(s) 358
BseSI GKGCMC 1 cut(s) 98
BshFI GGCC 1 cut(s) 313
BshNI GGYRCC 1 cut(s) 93
BsiHKCI CYCGRG 1 cut(s) 456
BslI CCNNNNNNNGG 1 cut(s) 457
BsnI GGCC 1 cut(s) 313
BsoBI CYCGRG 1 cut(s) 456
Bsp1286I GDGCHC 1 cut(s) 98
Bsp143I GATC 1 cut(s) 364
BspACI CCGC 2 cut(s) 142, 221
BspANI GGCC 1 cut(s) 313
BspCNI CTCAG 2 cut(s) 264, 321
BspLI GGNNCC 1 cut(s) 95
BspT107I GGYRCC 1 cut(s) 93
BsrDI GCAATG 1 cut(s) 436
BsrI ACTGG 1 cut(s) 121
BssMI GATC 1 cut(s) 364
Bst4CI ACNGT 2 cut(s) 86, 186
BstC8I GCNNGC 1 cut(s) 390
BstDEI CTNAG 2 cut(s) 251, 308
BstKTI GATC 1 cut(s) 367
BstMBI GATC 1 cut(s) 364
BstMWI GCNNNNNNNGC 2 cut(s) 167, 290
BstSFI CTRYAG 1 cut(s) 279
BstSLI GKGCMC 1 cut(s) 98
BsuRI GGCC 1 cut(s) 313
BtsIMutI CAGTG 1 cut(s) 182
Cac8I GCNNGC 1 cut(s) 390
Csp6I GTAC 1 cut(s) 6
CviAII CATG 1 cut(s) 167
CviQI GTAC 1 cut(s) 6
DdeI CTNAG 2 cut(s) 251, 308
DpnI GATC 1 cut(s) 366
DpnII GATC 1 cut(s) 364
Eco88I CYCGRG 1 cut(s) 456
FaeI CATG 1 cut(s) 170
FaiI YATR 6 cut(s) 81, 100, 168, 360, 405, 487
FalI AAGNNNNNCTT 2 cut(s) 332, 364
FatI CATG 1 cut(s) 166
FauI CCCGC 2 cut(s) 149, 228
FspBI CTAG 5 cut(s) 9, 24, 110, 131, 269
HaeIII GGCC 1 cut(s) 313
Hin1II CATG 1 cut(s) 170
HindIII AAGCTT 1 cut(s) 159
HinfI GANTC 4 cut(s) 19, 134, 216, 479
HphI GGTGA 1 cut(s) 391
Hpy166II GTNNAC 1 cut(s) 245
Hpy188I TCNGA 2 cut(s) 176, 369
Hpy188III TCNNGA 3 cut(s) 67, 110, 467
Hpy8I GTNNAC 1 cut(s) 245
HpyAV CCTTC 3 cut(s) 113, 181, 450
HpyCH4III ACNGT 2 cut(s) 86, 186
HpyCH4V TGCA 1 cut(s) 374
HpyF10VI GCNNNNNNNGC 2 cut(s) 167, 290
HpyF3I CTNAG 2 cut(s) 251, 308
Hsp92II CATG 1 cut(s) 170
Kzo9I GATC 1 cut(s) 364
LmnI GCTCC 1 cut(s) 345
LpnPI CCDG 3 cut(s) 63, 134, 295
LweI GCATC 1 cut(s) 142
MaeI CTAG 5 cut(s) 9, 24, 110, 131, 269
MaeIII GTNAC 3 cut(s) 86, 123, 379
MalI GATC 1 cut(s) 366
MboI GATC 1 cut(s) 364
MhlI GDGCHC 1 cut(s) 98
MluCI AATT 4 cut(s) 226, 260, 332, 446
MlyI GAGTC 2 cut(s) 13, 210
MnlI CCTC 4 cut(s) 46, 308, 336, 370
MroXI GAANNNNTTC 1 cut(s) 62
MseI TTAA 3 cut(s) 72, 264, 335
MwoI GCNNNNNNNGC 2 cut(s) 167, 290
NdeII GATC 1 cut(s) 364
NlaIII CATG 1 cut(s) 170
NlaIV GGNNCC 1 cut(s) 95
NmuCI GTSAC 2 cut(s) 123, 379
PdmI GAANNNNTTC 1 cut(s) 62
PfeI GAWTC 2 cut(s) 134, 479
PleI GAGTC 2 cut(s) 13, 210
PpsI GAGTC 2 cut(s) 13, 210
PspN4I GGNNCC 1 cut(s) 95
RsaI GTAC 1 cut(s) 7
RsaNI GTAC 1 cut(s) 6
SaqAI TTAA 3 cut(s) 72, 264, 335
Sau3AI GATC 1 cut(s) 364
SchI GAGTC 2 cut(s) 13, 210
SduI GDGCHC 1 cut(s) 98
SfaNI GCATC 1 cut(s) 142
SfcI CTRYAG 1 cut(s) 279
SmlI CTYRAG 1 cut(s) 393
SmoI CTYRAG 1 cut(s) 393
Sse9I AATT 4 cut(s) 226, 260, 332, 446
SsiI CCGC 2 cut(s) 142, 221
SspMI CTAG 5 cut(s) 9, 24, 110, 131, 269
TaaI ACNGT 2 cut(s) 86, 186
TasI AATT 4 cut(s) 226, 260, 332, 446
TfiI GAWTC 2 cut(s) 134, 479
Tru1I TTAA 3 cut(s) 72, 264, 335
Tru9I TTAA 3 cut(s) 72, 264, 335
TscAI CASTG 1 cut(s) 189
TseFI GTSAC 2 cut(s) 123, 379
Tsp45I GTSAC 2 cut(s) 123, 379
TspDTI ATGAA 2 cut(s) 95, 288
TspRI CASTG 1 cut(s) 189
XapI RAATTY 2 cut(s) 226, 260
XbaI TCTAGA 1 cut(s) 109
XmnI GAANNNNTTC 1 cut(s) 62
XspI CTAG 5 cut(s) 9, 24, 110, 131, 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.