FvH4_4g31600

transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0018720
Physical Location & Seq
Forward (+)
30679551 .. 30681058
1508 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g31600.t1

Sequence Viewer

Length: 297 bp
ATGTCTAGCAGAAGATCATCGCGTTCGAGGCAGTCGGGCAGTTCCAGGAATAACAACAACATCAGCGACGAGCAGATTGCTGATCTTGTATCCAAGTTACAGCAACTTCTCCCTGAGATTCGCCATAGGCGCTCAGACAATAAGGTGTCAGCATCCAAGGTCCTGCAGGAGACTTGCAACTACATCAAAAACTTACACAGAGAGGTCGACGACCTAAGTGAGCGCTTATCTCAGCTTTTGGCGACGACTGACATGGATTCCGACCAGGCTTCCATTATCCGGAGCTTACTTATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0008150 GO:0009314 GO:0009416 GO:0009628 GO:0050896
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HLH

Protein Analysis

99

Amino Acids

11.19

Weight (kDa)

9.03

Isoelectric Point (pI)

92.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
bHLH_ILI PF23174 22 - 97 4.3e-37 ILI bHLH domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018720)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g31600
malus_domestica MD13G1074300.v1.1 MD16G1075700.v1.1
prunus_persica Prupe.1G271700_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0440111
rosa_samantha Rh4AG375200 Rh4BG387500 Rh4CG402000
rosa_wichuraiana Rw4G032100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 207
AccII CGCG 1 cut(s) 22
AccIII TCCGGA 1 cut(s) 279
AfeI AGCGCT 1 cut(s) 224
AfiI CCNNNNNNNGG 1 cut(s) 279
AjnI CCWGG 2 cut(s) 44, 264
AluBI AGCT 2 cut(s) 235, 285
AluI AGCT 2 cut(s) 235, 285
Alw26I GTCTC 1 cut(s) 164
Aor13HI TCCGGA 1 cut(s) 279
Aor51HI AGCGCT 1 cut(s) 224
AspLEI GCGC 2 cut(s) 132, 225
AspS9I GGNCC 1 cut(s) 160
AvaII GGWCC 1 cut(s) 160
BcgI CGANNNNNNTGC 2 cut(s) 59, 93
BciT130I CCWGG 2 cut(s) 46, 266
BciVI GTATCC 1 cut(s) 100
BcoDI GTCTC 1 cut(s) 164
BfaI CTAG 1 cut(s) 6
BfmI CTRYAG 1 cut(s) 164
BfoI RGCGCY 2 cut(s) 133, 226
BfuI GTATCC 1 cut(s) 100
Bme1390I CCNGG 2 cut(s) 46, 266
Bme18I GGWCC 1 cut(s) 160
BmgT120I GGNCC 1 cut(s) 160
BmrFI CCNGG 2 cut(s) 46, 266
BmsI GCATC 1 cut(s) 161
BsaJI CCNNGG 1 cut(s) 156
BsaWI WCCGGW 1 cut(s) 279
Bsc4I CCNNNNNNNGG 1 cut(s) 279
BseAI TCCGGA 1 cut(s) 279
BseBI CCWGG 2 cut(s) 46, 266
BseDI CCNNGG 1 cut(s) 156
BseGI GGATG 1 cut(s) 152
BseLI CCNNNNNNNGG 1 cut(s) 279
BseMII CTCAG 3 cut(s) 105, 147, 245
Bsh1236I CGCG 1 cut(s) 22
BsiSI CCGG 1 cut(s) 280
BslI CCNNNNNNNGG 1 cut(s) 279
BsmAI GTCTC 1 cut(s) 164
Bsp13I TCCGGA 1 cut(s) 279
Bsp143I GATC 2 cut(s) 14, 82
BspCNI CTCAG 3 cut(s) 106, 146, 244
BspEI TCCGGA 1 cut(s) 279
BspFNI CGCG 1 cut(s) 22
BspMAI CTGCAG 1 cut(s) 168
BssECI CCNNGG 1 cut(s) 156
BssMI GATC 2 cut(s) 14, 82
BssT1I CCWWGG 1 cut(s) 156
Bst2UI CCWGG 2 cut(s) 46, 266
BstDEI CTNAG 4 cut(s) 114, 133, 215, 231
BstF5I GGATG 1 cut(s) 152
BstFNI CGCG 1 cut(s) 22
BstH2I RGCGCY 2 cut(s) 133, 226
BstHHI GCGC 2 cut(s) 132, 225
BstKTI GATC 2 cut(s) 17, 85
BstMAI GTCTC 1 cut(s) 164
BstMBI GATC 2 cut(s) 14, 82
BstMWI GCNNNNNNNGC 2 cut(s) 28, 129
BstNI CCWGG 2 cut(s) 46, 266
BstSCI CCNGG 2 cut(s) 44, 264
BstSFI CTRYAG 1 cut(s) 164
BstUI CGCG 1 cut(s) 22
BsuI GTATCC 1 cut(s) 100
BtgZI GCGATG 1 cut(s) 3
BtsCI GGATG 1 cut(s) 152
CfoI GCGC 2 cut(s) 132, 225
Cfr13I GGNCC 1 cut(s) 160
CviAII CATG 1 cut(s) 253
CviJI RGCY 3 cut(s) 235, 269, 285
CviKI_1 RGCY 3 cut(s) 235, 269, 285
DdeI CTNAG 4 cut(s) 114, 133, 215, 231
DpnI GATC 2 cut(s) 16, 84
DpnII GATC 2 cut(s) 14, 82
Eco130I CCWWGG 1 cut(s) 156
Eco47I GGWCC 1 cut(s) 160
Eco47III AGCGCT 1 cut(s) 224
EcoO109I RGGNCCY 1 cut(s) 160
EcoRII CCWGG 2 cut(s) 44, 264
EcoT14I CCWWGG 1 cut(s) 156
ErhI CCWWGG 1 cut(s) 156
FaeI CATG 1 cut(s) 256
FaiI YATR 3 cut(s) 126, 254, 293
FatI CATG 1 cut(s) 252
FblI GTMKAC 1 cut(s) 207
FokI GGATG 1 cut(s) 139
FspBI CTAG 1 cut(s) 6
GlaI GCGC 2 cut(s) 131, 224
HaeII RGCGCY 2 cut(s) 133, 226
HapII CCGG 1 cut(s) 280
HhaI GCGC 2 cut(s) 132, 225
Hin1II CATG 1 cut(s) 256
Hin6I GCGC 2 cut(s) 130, 223
HinP1I GCGC 2 cut(s) 130, 223
HincII GTYRAC 1 cut(s) 208
HindII GTYRAC 1 cut(s) 208
HinfI GANTC 2 cut(s) 118, 257
HpaII CCGG 1 cut(s) 280
Hpy166II GTNNAC 1 cut(s) 208
Hpy188I TCNGA 2 cut(s) 136, 262
Hpy188III TCNNGA 1 cut(s) 280
Hpy8I GTNNAC 1 cut(s) 208
Hpy99I CGWCG 3 cut(s) 71, 212, 247
HpyCH4V TGCA 2 cut(s) 166, 177
HpyF10VI GCNNNNNNNGC 2 cut(s) 28, 129
HpyF3I CTNAG 4 cut(s) 114, 133, 215, 231
Hsp92II CATG 1 cut(s) 256
HspAI GCGC 2 cut(s) 130, 223
Kpn2I TCCGGA 1 cut(s) 279
Kzo9I GATC 2 cut(s) 14, 82
LmnI GCTCC 1 cut(s) 282
LpnPI CCDG 8 cut(s) 31, 58, 126, 152, 176, 251, 278, 293
LweI GCATC 1 cut(s) 161
MaeI CTAG 1 cut(s) 6
MaeIII GTNAC 1 cut(s) 96
MalI GATC 2 cut(s) 16, 84
MboI GATC 2 cut(s) 14, 82
MboII GAAGA 1 cut(s) 24
MmeI TCCRAC 1 cut(s) 285
MnlI CCTC 2 cut(s) 21, 196
MroI TCCGGA 1 cut(s) 279
MspI CCGG 1 cut(s) 280
MspR9I CCNGG 2 cut(s) 46, 266
MvaI CCWGG 2 cut(s) 46, 266
MvnI CGCG 1 cut(s) 22
MwoI GCNNNNNNNGC 2 cut(s) 28, 129
NdeII GATC 2 cut(s) 14, 82
NlaIII CATG 1 cut(s) 256
PfeI GAWTC 2 cut(s) 118, 257
PfoI TCCNGGA 1 cut(s) 44
PpuMI RGGWCCY 1 cut(s) 160
Psp5II RGGWCCY 1 cut(s) 160
Psp6I CCWGG 2 cut(s) 44, 264
PspGI CCWGG 2 cut(s) 44, 264
PspPI GGNCC 1 cut(s) 160
PspPPI RGGWCCY 1 cut(s) 160
PstI CTGCAG 1 cut(s) 168
SalI GTCGAC 1 cut(s) 206
Sau3AI GATC 2 cut(s) 14, 82
Sau96I GGNCC 1 cut(s) 160
SbfI CCTGCAGG 1 cut(s) 168
ScrFI CCNGG 2 cut(s) 46, 266
SdaI CCTGCAGG 1 cut(s) 168
SetI ASST 6 cut(s) 147, 162, 207, 216, 237, 287
SfaNI GCATC 1 cut(s) 161
SfcI CTRYAG 1 cut(s) 164
SinI GGWCC 1 cut(s) 160
Sse8387I CCTGCAGG 1 cut(s) 168
SspMI CTAG 1 cut(s) 6
StyD4I CCNGG 2 cut(s) 44, 264
StyI CCWWGG 1 cut(s) 156
TaqI TCGA 2 cut(s) 26, 207
TfiI GAWTC 2 cut(s) 118, 257
VpaK11BI GGWCC 1 cut(s) 160
XmiI GTMKAC 1 cut(s) 207
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.