FvH4_6g51540

Encoded by

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0022259
Physical Location & Seq
Forward (+)
38197688 .. 38201783
4096 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g51540.t1

Sequence Viewer

Length: 282 bp
ATGGACACTGAAGCACATCCTGAAGTTTCAAAAGACATCTTACAGATCTTATGGAGTGTTAGCATCTCTACTCATCCTGGTCTGGAGACACAGTGGGCAAAGGCAAGGGCCTCTTCCGTTGAGGCCATGGCCCAATTTGAGGTATCACATACTGAACAAACAATTCAAGATTTCAAGAAAAGGAATCTAGAGTTGCTTTCTTGTGAATCAAACATCACTGTACTAAATGCCATGGAAGAACTTCTAGTCAAGATAATAACACACGAGCACCTAACAAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF3730

Protein Analysis

94

Amino Acids

10.58

Weight (kDa)

5.23

Isoelectric Point (pI)

40.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022259)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g51540 FvH4_6g51560
pyrus_communis pycom17g02690
rosa_samantha Rh2AG643700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 30, 42
AfaI GTAC 1 cut(s) 222
AfiI CCNNNNNNNGG 1 cut(s) 139
AgsI TTSAA 3 cut(s) 30, 167, 175
AjnI CCWGG 1 cut(s) 76
Alw21I GWGCWC 1 cut(s) 270
Alw26I GTCTC 1 cut(s) 80
AoxI GGCC 3 cut(s) 108, 123, 129
Asp700I GAANNNNTTC 1 cut(s) 240
AspS9I GGNCC 2 cut(s) 108, 130
BauI CACGAG 1 cut(s) 263
Bbv12I GWGCWC 1 cut(s) 270
BciT130I CCWGG 1 cut(s) 78
BcoDI GTCTC 1 cut(s) 80
BfaI CTAG 2 cut(s) 188, 245
BglII AGATCT 1 cut(s) 45
Bme1390I CCNGG 1 cut(s) 78
BmgT120I GGNCC 2 cut(s) 108, 130
BmrFI CCNGG 1 cut(s) 78
BmsI GCATC 1 cut(s) 72
BpmI CTGGAG 1 cut(s) 104
BsaJI CCNNGG 2 cut(s) 126, 231
BsaXI ACNNNNNCTCC 2 cut(s) 77, 107
Bsc4I CCNNNNNNNGG 1 cut(s) 139
BseBI CCWGG 1 cut(s) 78
BseDI CCNNGG 2 cut(s) 126, 231
BseGI GGATG 2 cut(s) 16, 73
BseLI CCNNNNNNNGG 1 cut(s) 139
BshFI GGCC 3 cut(s) 110, 125, 131
BsiHKAI GWGCWC 1 cut(s) 270
BslI CCNNNNNNNGG 1 cut(s) 139
BsmAI GTCTC 1 cut(s) 80
BsnI GGCC 3 cut(s) 110, 125, 131
Bsp1286I GDGCHC 1 cut(s) 270
Bsp143I GATC 1 cut(s) 45
Bsp19I CCATGG 2 cut(s) 126, 231
BspANI GGCC 3 cut(s) 110, 125, 131
BssECI CCNNGG 2 cut(s) 126, 231
BssMI GATC 1 cut(s) 45
BssSI CACGAG 1 cut(s) 263
BssT1I CCWWGG 2 cut(s) 126, 231
Bst2BI CACGAG 1 cut(s) 263
Bst2UI CCWGG 1 cut(s) 78
Bst4CI ACNGT 2 cut(s) 93, 220
Bst6I CTCTTC 1 cut(s) 118
BstDSI CCRYGG 2 cut(s) 126, 231
BstF5I GGATG 2 cut(s) 16, 73
BstKTI GATC 1 cut(s) 48
BstMAI GTCTC 1 cut(s) 80
BstMBI GATC 1 cut(s) 45
BstNI CCWGG 1 cut(s) 78
BstSCI CCNGG 1 cut(s) 76
BstX2I RGATCY 1 cut(s) 45
BstYI RGATCY 1 cut(s) 45
BsuRI GGCC 3 cut(s) 110, 125, 131
BtgI CCRYGG 2 cut(s) 126, 231
BtsCI GGATG 2 cut(s) 16, 73
BtsIMutI CAGTG 3 cut(s) 6, 98, 216
Cfr13I GGNCC 2 cut(s) 108, 130
Csp6I GTAC 1 cut(s) 221
CviAII CATG 2 cut(s) 127, 232
CviJI RGCY 3 cut(s) 110, 125, 131
CviKI_1 RGCY 3 cut(s) 110, 125, 131
CviQI GTAC 1 cut(s) 221
DpnI GATC 1 cut(s) 47
DpnII GATC 1 cut(s) 45
Eam1104I CTCTTC 1 cut(s) 118
EarI CTCTTC 1 cut(s) 118
Eco130I CCWWGG 2 cut(s) 126, 231
Eco57I CTGAAG 2 cut(s) 30, 42
EcoO109I RGGNCCY 1 cut(s) 108
EcoRII CCWGG 1 cut(s) 76
EcoT14I CCWWGG 2 cut(s) 126, 231
ErhI CCWWGG 2 cut(s) 126, 231
FaeI CATG 2 cut(s) 130, 235
FaiI YATR 4 cut(s) 52, 128, 150, 233
FalI AAGNNNNNCTT 2 cut(s) 97, 129
FatI CATG 2 cut(s) 126, 231
FokI GGATG 2 cut(s) 3, 60
FspBI CTAG 2 cut(s) 188, 245
GsuI CTGGAG 1 cut(s) 104
HaeIII GGCC 3 cut(s) 110, 125, 131
Hin1II CATG 2 cut(s) 130, 235
HinfI GANTC 2 cut(s) 184, 206
Hpy188III TCNNGA 6 cut(s) 20, 83, 167, 175, 188, 250
HpyCH4III ACNGT 2 cut(s) 93, 220
Hsp92II CATG 2 cut(s) 130, 235
Kzo9I GATC 1 cut(s) 45
LpnPI CCDG 4 cut(s) 33, 63, 68, 90
LweI GCATC 1 cut(s) 72
MaeI CTAG 2 cut(s) 188, 245
MalI GATC 1 cut(s) 47
MboI GATC 1 cut(s) 45
MboII GAAGA 2 cut(s) 105, 248
MflI RGATCY 1 cut(s) 45
MhlI GDGCHC 1 cut(s) 270
MluCI AATT 2 cut(s) 134, 162
MnlI CCTC 3 cut(s) 115, 121, 133
MroXI GAANNNNTTC 1 cut(s) 240
MspR9I CCNGG 1 cut(s) 78
MvaI CCWGG 1 cut(s) 78
NcoI CCATGG 2 cut(s) 126, 231
NdeII GATC 1 cut(s) 45
NlaIII CATG 2 cut(s) 130, 235
PdmI GAANNNNTTC 1 cut(s) 240
PfeI GAWTC 2 cut(s) 184, 206
Psp6I CCWGG 1 cut(s) 76
PspGI CCWGG 1 cut(s) 76
PspPI GGNCC 2 cut(s) 108, 130
PsuI RGATCY 1 cut(s) 45
RsaI GTAC 1 cut(s) 222
RsaNI GTAC 1 cut(s) 221
Sau3AI GATC 1 cut(s) 45
Sau96I GGNCC 2 cut(s) 108, 130
ScrFI CCNGG 1 cut(s) 78
SduI GDGCHC 1 cut(s) 270
SetI ASST 3 cut(s) 144, 273, 281
SfaNI GCATC 1 cut(s) 72
Sse9I AATT 2 cut(s) 134, 162
SspMI CTAG 2 cut(s) 188, 245
StyD4I CCNGG 1 cut(s) 76
StyI CCWWGG 2 cut(s) 126, 231
TaaI ACNGT 2 cut(s) 93, 220
TasI AATT 2 cut(s) 134, 162
TatI WGTACW 1 cut(s) 220
TfiI GAWTC 2 cut(s) 184, 206
TscAI CASTG 3 cut(s) 13, 98, 223
TspGWI ACGGA 1 cut(s) 106
TspRI CASTG 3 cut(s) 13, 98, 223
XbaI TCTAGA 1 cut(s) 187
XmnI GAANNNNTTC 1 cut(s) 240
XspI CTAG 2 cut(s) 188, 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.