FvH4_7g05260

RING-H2 finger protein

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
Physical Location & Seq
Reverse (-)
5581876 .. 5582598
723 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g05260.t1

Sequence Viewer

Length: 438 bp
ATGAGCATTCTAAGTGGATTTGGTTATGTTCTTGCGCTACTAGTTCTACTTCTCTGCCTTGCTTCCTACCTCTGCTCTAAACGCGCACGATTATCCATAGCCGCCGGTGACCAGACCAGCACTGGTAGTGAACAAGCTGCAGGTGGAGCTGGACTTGATGAAGCCACTATAACTAGTTACCCAAAACTTGCTTATTCCAAAGTAAAGCTCCAACATGGAAACTCAACTGCTTGTTGCTGCTCCATTTGTTTGGCTGACTACAAGGAAACCGATATGCTTTTAGTGTTGCCACATTGCGGTCATCCCTTCCATGTCAAGTGTGTTCATCCATGGCTTCGGCTTCACGCTACGTGCCCAATATGCAGGAACTCGCCTTCTCCACCTTCTCTCTGTATCCCATTTAGTCAAATAACCCCCTTGGCTACGCTGCCGGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

146

Amino Acids

15.46

Weight (kDa)

8.02

Isoelectric Point (pI)

43.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-rbx1 PF12678 77 - 122 2.4e-07 RING-H2 zinc finger domain
zf-RING_2 PF13639 79 - 122 5.9e-11 Ring finger domain
zf-RING_11 PF17123 80 - 108 5.3e-09 RING-like zinc finger
zf-C3HC4 PF00097 80 - 121 1.1e-06 Zinc finger, C3HC4 type (RING finger)
zf-C3HC4_2 PF13923 80 - 121 1.9e-06 Zinc finger, C3HC4 type (RING finger)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019726)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g05260
rosa_chinensis RchiOBHm_Chr1g0332051
rosa_laevigata RLG00000029696
rosa_roxburghii Rroxscaffold_4G00318420
rosa_samantha Rh1AG121900 Rh1BG093300 Rh1DG127600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 131
Acc36I ACCTGC 1 cut(s) 131
AccII CGCG 1 cut(s) 84
AciI CCGC 2 cut(s) 102, 297
AfiI CCNNNNNNNGG 1 cut(s) 296
AhlI ACTAGT 2 cut(s) 40, 173
AluBI AGCT 3 cut(s) 137, 149, 208
AluI AGCT 3 cut(s) 137, 149, 208
ApeKI GCWGC 3 cut(s) 137, 237, 427
AspLEI GCGC 2 cut(s) 37, 86
AsuHPI GGTGA 1 cut(s) 119
BaeGI GKGCMC 1 cut(s) 356
BbvI GCAGC 3 cut(s) 124, 224, 414
BciVI GTATCC 1 cut(s) 404
BcuI ACTAGT 2 cut(s) 40, 173
BfaI CTAG 2 cut(s) 41, 174
BfmI CTRYAG 1 cut(s) 138
BfuAI ACCTGC 1 cut(s) 131
BfuI GTATCC 1 cut(s) 404
BisI GCNGC 4 cut(s) 102, 138, 238, 428
BlsI GCNGC 4 cut(s) 103, 139, 239, 429
BsaAI YACGTR 1 cut(s) 351
BsaJI CCNNGG 2 cut(s) 329, 417
Bsc4I CCNNNNNNNGG 1 cut(s) 296
Bse118I RCCGGY 1 cut(s) 104
Bse1I ACTGG 1 cut(s) 127
Bse3DI GCAATG 1 cut(s) 292
BseDI CCNNGG 2 cut(s) 329, 417
BseGI GGATG 2 cut(s) 301, 325
BseLI CCNNNNNNNGG 1 cut(s) 296
BseMI GCAATG 1 cut(s) 292
BseNI ACTGG 1 cut(s) 127
BseSI GKGCMC 1 cut(s) 356
BseXI GCAGC 3 cut(s) 124, 224, 414
Bsh1236I CGCG 1 cut(s) 84
BsiSI CCGG 2 cut(s) 105, 431
BslI CCNNNNNNNGG 1 cut(s) 296
BsmI GAATGC 1 cut(s) 6
Bsp1286I GDGCHC 1 cut(s) 356
Bsp19I CCATGG 1 cut(s) 329
BspACI CCGC 2 cut(s) 102, 297
BspFNI CGCG 1 cut(s) 84
BspMAI CTGCAG 1 cut(s) 142
BspMI ACCTGC 1 cut(s) 131
BsrDI GCAATG 1 cut(s) 292
BsrFI RCCGGY 1 cut(s) 104
BsrI ACTGG 1 cut(s) 127
BssAI RCCGGY 1 cut(s) 104
BssECI CCNNGG 2 cut(s) 329, 417
BssT1I CCWWGG 2 cut(s) 329, 417
BstBAI YACGTR 1 cut(s) 351
BstDEI CTNAG 1 cut(s) 11
BstDSI CCRYGG 1 cut(s) 329
BstEII GGTNACC 1 cut(s) 107
BstF5I GGATG 2 cut(s) 301, 325
BstFNI CGCG 1 cut(s) 84
BstHHI GCGC 2 cut(s) 37, 86
BstMWI GCNNNNNNNGC 3 cut(s) 81, 146, 360
BstPI GGTNACC 1 cut(s) 107
BstSFI CTRYAG 1 cut(s) 138
BstSLI GKGCMC 1 cut(s) 356
BstUI CGCG 1 cut(s) 84
BstV1I GCAGC 3 cut(s) 124, 224, 414
BstXI CCANNNNNNTGG 1 cut(s) 250
BsuI GTATCC 1 cut(s) 404
BtgI CCRYGG 1 cut(s) 329
BtsCI GGATG 2 cut(s) 301, 325
BtsIMutI CAGTG 1 cut(s) 120
BveI ACCTGC 1 cut(s) 131
CfoI GCGC 2 cut(s) 37, 86
Cfr10I RCCGGY 1 cut(s) 104
CviAII CATG 3 cut(s) 215, 311, 330
CviJI RGCY 9 cut(s) 101, 137, 149, 164, 208, 254, 334, 340, 422
CviKI_1 RGCY 9 cut(s) 101, 137, 149, 164, 208, 254, 334, 340, 422
DdeI CTNAG 1 cut(s) 11
Eco130I CCWWGG 2 cut(s) 329, 417
Eco91I GGTNACC 1 cut(s) 107
EcoO65I GGTNACC 1 cut(s) 107
EcoT14I CCWWGG 2 cut(s) 329, 417
ErhI CCWWGG 2 cut(s) 329, 417
FaeI CATG 3 cut(s) 218, 314, 333
FaiI YATR 8 cut(s) 27, 98, 170, 216, 275, 312, 331, 361
FatI CATG 3 cut(s) 214, 310, 329
Fnu4HI GCNGC 4 cut(s) 102, 138, 238, 428
FokI GGATG 2 cut(s) 288, 312
Fsp4HI GCNGC 4 cut(s) 102, 138, 238, 428
FspBI CTAG 2 cut(s) 41, 174
GlaI GCGC 2 cut(s) 36, 85
GluI GCNGC 4 cut(s) 102, 138, 238, 428
HapII CCGG 2 cut(s) 105, 431
HhaI GCGC 2 cut(s) 37, 86
Hin1II CATG 3 cut(s) 218, 314, 333
Hin6I GCGC 2 cut(s) 35, 84
HinP1I GCGC 2 cut(s) 35, 84
HpaII CCGG 2 cut(s) 105, 431
HphI GGTGA 1 cut(s) 119
Hpy166II GTNNAC 1 cut(s) 131
Hpy8I GTNNAC 1 cut(s) 131
HpyAV CCTTC 3 cut(s) 316, 384, 393
HpyCH4IV ACGT 1 cut(s) 350
HpyCH4V TGCA 2 cut(s) 140, 363
HpyF10VI GCNNNNNNNGC 3 cut(s) 81, 146, 360
HpyF3I CTNAG 1 cut(s) 11
HpySE526I ACGT 1 cut(s) 350
Hsp92II CATG 3 cut(s) 218, 314, 333
HspAI GCGC 2 cut(s) 35, 84
LmnI GCTCC 3 cut(s) 146, 213, 245
LpnPI CCDG 7 cut(s) 108, 118, 125, 126, 130, 135, 349
Lsp1109I GCAGC 3 cut(s) 124, 224, 414
MaeI CTAG 2 cut(s) 41, 174
MaeII ACGT 1 cut(s) 350
MaeIII GTNAC 2 cut(s) 107, 176
MhlI GDGCHC 1 cut(s) 356
MmeI TCCRAC 1 cut(s) 235
MnlI CCTC 1 cut(s) 80
MspI CCGG 2 cut(s) 105, 431
Mva1269I GAATGC 1 cut(s) 6
MvnI CGCG 1 cut(s) 84
MwoI GCNNNNNNNGC 3 cut(s) 81, 146, 360
NcoI CCATGG 1 cut(s) 329
NlaIII CATG 3 cut(s) 218, 314, 333
NmuCI GTSAC 1 cut(s) 107
PaqCI CACCTGC 1 cut(s) 131
PctI GAATGC 1 cut(s) 6
PkrI GCNGC 4 cut(s) 103, 139, 239, 429
Ppu21I YACGTR 1 cut(s) 351
PspEI GGTNACC 1 cut(s) 107
PstI CTGCAG 1 cut(s) 142
SatI GCNGC 4 cut(s) 102, 138, 238, 428
SduI GDGCHC 1 cut(s) 356
SetI ASST 7 cut(s) 72, 139, 145, 151, 210, 353, 385
SfcI CTRYAG 1 cut(s) 138
SgrAI CRCCGGYG 1 cut(s) 104
SpeI ACTAGT 2 cut(s) 40, 173
SsiI CCGC 2 cut(s) 102, 297
SspMI CTAG 2 cut(s) 41, 174
StyI CCWWGG 2 cut(s) 329, 417
TaiI ACGT 1 cut(s) 353
TauI GCSGC 1 cut(s) 104
TscAI CASTG 1 cut(s) 127
TseFI GTSAC 1 cut(s) 107
TseI GCWGC 3 cut(s) 137, 237, 427
Tsp45I GTSAC 1 cut(s) 107
TspDTI ATGAA 2 cut(s) 174, 314
TspRI CASTG 1 cut(s) 127
XcmI CCANNNNNNNNNTGG 1 cut(s) 119
XspI CTAG 2 cut(s) 41, 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.