MD00G1048700.v1.1

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Reverse (-)
9117769 .. 9118195
427 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1048700.v1.1.491

Sequence Viewer

Length: 252 bp
ATGTATGTAACCGATTGCATATCATTGAAAAAAGTAACATATCAATCGTTTGAGGGGCTCCAACTAGAGGCCTTTGTGAGAAACAACAAAAACACAGTTGAGTGGGAGTACCTTTTCAAGTTAGAGTCTATTGATAGAGTTGATGTGGAGATGATCAAACTTTTGGGCTTGTGCAACTTGGGATCCATGCCACCCATTACAATGAACGCATTTCCATTCTCAAGCTATGGTTCAAAAGTGAGGACTGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.55

Weight (kDa)

6.18

Isoelectric Point (pI)

26.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021195)

Species Orthologous Gene IDs
malus_domestica MD00G1048700.v1.1
rosa_roxburghii Rroxscaffold_4G00306750
rosa_samantha Rh1AG211900 Rh1CG196200 Rh1CG198900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 177, 190
AfaI GTAC 1 cut(s) 110
AfiI CCNNNNNNNGG 1 cut(s) 67
AgsI TTSAA 3 cut(s) 28, 118, 234
AluBI AGCT 1 cut(s) 225
AluI AGCT 1 cut(s) 225
AlwI GGATC 2 cut(s) 177, 190
AoxI GGCC 1 cut(s) 69
BamHI GGATCC 1 cut(s) 182
BanII GRGCYC 1 cut(s) 60
BclI TGATCA 1 cut(s) 153
BfaI CTAG 1 cut(s) 65
BmiI GGNNCC 2 cut(s) 59, 184
BpuEI CTTGAG 1 cut(s) 205
Bsc4I CCNNNNNNNGG 1 cut(s) 67
BseLI CCNNNNNNNGG 1 cut(s) 67
BshFI GGCC 1 cut(s) 71
BslI CCNNNNNNNGG 1 cut(s) 67
BsnI GGCC 1 cut(s) 71
Bsp1286I GDGCHC 1 cut(s) 60
Bsp143I GATC 2 cut(s) 153, 182
BspANI GGCC 1 cut(s) 71
BspLI GGNNCC 2 cut(s) 59, 184
BspPI GGATC 2 cut(s) 177, 190
BssMI GATC 2 cut(s) 153, 182
Bst4CI ACNGT 2 cut(s) 97, 247
BstKTI GATC 2 cut(s) 156, 185
BstMBI GATC 2 cut(s) 153, 182
BstX2I RGATCY 1 cut(s) 182
BstYI RGATCY 1 cut(s) 182
BsuRI GGCC 1 cut(s) 71
Csp6I GTAC 1 cut(s) 109
CviAII CATG 1 cut(s) 187
CviJI RGCY 4 cut(s) 58, 71, 168, 225
CviKI_1 RGCY 4 cut(s) 58, 71, 168, 225
CviQI GTAC 1 cut(s) 109
DpnI GATC 2 cut(s) 155, 184
DpnII GATC 2 cut(s) 153, 182
Eco147I AGGCCT 1 cut(s) 71
Eco24I GRGCYC 1 cut(s) 60
EcoT38I GRGCYC 1 cut(s) 60
FaeI CATG 1 cut(s) 190
FaiI YATR 6 cut(s) 6, 20, 40, 188, 228, 250
FatI CATG 1 cut(s) 186
FbaI TGATCA 1 cut(s) 153
FriOI GRGCYC 1 cut(s) 60
FspBI CTAG 1 cut(s) 65
HaeIII GGCC 1 cut(s) 71
Hin1II CATG 1 cut(s) 190
HinfI GANTC 1 cut(s) 125
HpyCH4III ACNGT 2 cut(s) 97, 247
HpyCH4V TGCA 2 cut(s) 18, 174
Hsp92II CATG 1 cut(s) 190
Ksp22I TGATCA 1 cut(s) 153
Kzo9I GATC 2 cut(s) 153, 182
LmnI GCTCC 1 cut(s) 63
MaeI CTAG 1 cut(s) 65
MaeIII GTNAC 2 cut(s) 7, 34
MalI GATC 2 cut(s) 155, 184
MboI GATC 2 cut(s) 153, 182
MflI RGATCY 1 cut(s) 182
MhlI GDGCHC 1 cut(s) 60
MlyI GAGTC 1 cut(s) 134
MmeI TCCRAC 1 cut(s) 85
MnlI CCTC 3 cut(s) 46, 61, 234
MslI CAYNNNNRTG 1 cut(s) 200
NdeII GATC 2 cut(s) 153, 182
NlaIII CATG 1 cut(s) 190
NlaIV GGNNCC 2 cut(s) 59, 184
PceI AGGCCT 1 cut(s) 71
PleI GAGTC 1 cut(s) 133
PpsI GAGTC 1 cut(s) 133
PspN4I GGNNCC 2 cut(s) 59, 184
PsuI RGATCY 1 cut(s) 182
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
RseI CAYNNNNRTG 1 cut(s) 200
Sau3AI GATC 2 cut(s) 153, 182
SchI GAGTC 1 cut(s) 134
SduI GDGCHC 1 cut(s) 60
SetI ASST 2 cut(s) 114, 227
SgeI CNNG 6 cut(s) 77, 130, 181, 190, 199, 234
SmiMI CAYNNNNRTG 1 cut(s) 200
SmlI CTYRAG 1 cut(s) 220
SmoI CTYRAG 1 cut(s) 220
SseBI AGGCCT 1 cut(s) 71
SspMI CTAG 1 cut(s) 65
StuI AGGCCT 1 cut(s) 71
TaaI ACNGT 2 cut(s) 97, 247
TspDTI ATGAA 1 cut(s) 218
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.