MD00G1051100.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
OG0022242
Physical Location & Seq
Forward (+)
9653924 .. 9654767
844 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1051100.v1.1.491

Sequence Viewer

Length: 207 bp
ATGCCACCACCATGGGGACCGCCGGGAGGAGGAGGTCCGGGAGGGTTTGGTTGCTTAGGTGACCTCTGCAGCGGTATATGCAGCTTTATCTCATCTTGTGCTTATATCTTGTGCTGCTGCTGCTTGTTTGAGAGCTGCTGTGGACCAGTGTTCGGCGGCGGCCCTGGCGGACCAGGTGGCCCTGGCGGTGGCCCCCCTCGTTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

6.47

Weight (kDa)

4.37

Isoelectric Point (pI)

76.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022242)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g04150
malus_domestica MD00G1051100.v1.1
prunus_persica Prupe.6G336000_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0452741

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 6 cut(s) 20, 72, 156, 159, 168, 186
AfiI CCNNNNNNNGG 6 cut(s) 14, 26, 29, 152, 188, 201
AjnI CCWGG 3 cut(s) 163, 172, 181
AluBI AGCT 2 cut(s) 84, 135
AluI AGCT 2 cut(s) 84, 135
AoxI GGCC 3 cut(s) 160, 178, 190
ApeKI GCWGC 6 cut(s) 69, 81, 114, 117, 120, 135
AspS9I GGNCC 7 cut(s) 17, 35, 143, 161, 170, 179, 191
AsuC2I CCSGG 2 cut(s) 24, 39
AsuHPI GGTGA 1 cut(s) 71
AvaII GGWCC 4 cut(s) 17, 35, 143, 170
BbvI GCAGC 6 cut(s) 81, 93, 101, 104, 107, 122
BciT130I CCWGG 3 cut(s) 165, 174, 183
BcnI CCSGG 2 cut(s) 24, 39
BfmI CTRYAG 1 cut(s) 67
BisI GCNGC 8 cut(s) 70, 82, 115, 118, 121, 136, 157, 160
BlsI GCNGC 8 cut(s) 71, 83, 116, 119, 122, 137, 158, 161
Bme1390I CCNGG 5 cut(s) 24, 39, 165, 174, 183
Bme18I GGWCC 4 cut(s) 17, 35, 143, 170
BmgT120I GGNCC 7 cut(s) 17, 35, 143, 161, 170, 179, 191
BmiI GGNNCC 2 cut(s) 18, 193
BmrFI CCNGG 5 cut(s) 24, 39, 165, 174, 183
Bpu10I CCTNAGC 1 cut(s) 55
BpuMI CCSGG 2 cut(s) 24, 39
BsaJI CCNNGG 3 cut(s) 11, 163, 181
Bsc4I CCNNNNNNNGG 6 cut(s) 14, 26, 29, 152, 188, 201
Bse1I ACTGG 1 cut(s) 146
BseBI CCWGG 3 cut(s) 165, 174, 183
BseDI CCNNGG 3 cut(s) 11, 163, 181
BseLI CCNNNNNNNGG 6 cut(s) 14, 26, 29, 152, 188, 201
BseNI ACTGG 1 cut(s) 146
BseRI GAGGAG 2 cut(s) 42, 45
BseXI GCAGC 6 cut(s) 81, 93, 101, 104, 107, 122
BshFI GGCC 3 cut(s) 162, 180, 192
BsiSI CCGG 2 cut(s) 23, 38
BslFI GGGAC 1 cut(s) 30
BslI CCNNNNNNNGG 6 cut(s) 14, 26, 29, 152, 188, 201
BsmFI GGGAC 1 cut(s) 30
BsnI GGCC 3 cut(s) 162, 180, 192
Bsp19I CCATGG 1 cut(s) 11
BspACI CCGC 6 cut(s) 20, 72, 156, 159, 168, 186
BspANI GGCC 3 cut(s) 162, 180, 192
BspLI GGNNCC 2 cut(s) 18, 193
BspMAI CTGCAG 1 cut(s) 71
BsrI ACTGG 1 cut(s) 146
BssECI CCNNGG 3 cut(s) 11, 163, 181
BssT1I CCWWGG 1 cut(s) 11
Bst2UI CCWGG 3 cut(s) 165, 174, 183
BstDEI CTNAG 1 cut(s) 55
BstDSI CCRYGG 1 cut(s) 11
BstEII GGTNACC 1 cut(s) 59
BstMWI GCNNNNNNNGC 3 cut(s) 78, 120, 165
BstNI CCWGG 3 cut(s) 165, 174, 183
BstPI GGTNACC 1 cut(s) 59
BstSCI CCNGG 5 cut(s) 22, 37, 163, 172, 181
BstSFI CTRYAG 1 cut(s) 67
BstV1I GCAGC 6 cut(s) 81, 93, 101, 104, 107, 122
BstXI CCANNNNNNTGG 1 cut(s) 12
BsuRI GGCC 3 cut(s) 162, 180, 192
BtgI CCRYGG 1 cut(s) 11
BtsIMutI CAGTG 1 cut(s) 153
Cfr13I GGNCC 7 cut(s) 17, 35, 143, 161, 170, 179, 191
CsiI ACCWGGT 1 cut(s) 172
CviAII CATG 1 cut(s) 12
CviJI RGCY 5 cut(s) 84, 135, 162, 180, 192
CviKI_1 RGCY 5 cut(s) 84, 135, 162, 180, 192
DdeI CTNAG 1 cut(s) 55
EciI GGCGGA 1 cut(s) 183
Eco130I CCWWGG 1 cut(s) 11
Eco47I GGWCC 4 cut(s) 17, 35, 143, 170
Eco91I GGTNACC 1 cut(s) 59
EcoO65I GGTNACC 1 cut(s) 59
EcoRII CCWGG 3 cut(s) 163, 172, 181
EcoT14I CCWWGG 1 cut(s) 11
ErhI CCWWGG 1 cut(s) 11
FaeI CATG 1 cut(s) 15
FaiI YATR 4 cut(s) 13, 77, 79, 105
FaqI GGGAC 1 cut(s) 30
FatI CATG 1 cut(s) 11
Fnu4HI GCNGC 8 cut(s) 70, 82, 115, 118, 121, 136, 157, 160
Fsp4HI GCNGC 8 cut(s) 70, 82, 115, 118, 121, 136, 157, 160
GluI GCNGC 8 cut(s) 70, 82, 115, 118, 121, 136, 157, 160
HaeIII GGCC 3 cut(s) 162, 180, 192
HapII CCGG 2 cut(s) 23, 38
Hin1II CATG 1 cut(s) 15
HpaII CCGG 2 cut(s) 23, 38
HphI GGTGA 1 cut(s) 71
Hpy166II GTNNAC 1 cut(s) 143
Hpy8I GTNNAC 1 cut(s) 143
HpyCH4V TGCA 2 cut(s) 69, 81
HpyF10VI GCNNNNNNNGC 3 cut(s) 78, 120, 165
HpyF3I CTNAG 1 cut(s) 55
Hsp92II CATG 1 cut(s) 15
LpnPI CCDG 9 cut(s) 36, 51, 150, 159, 159, 168, 177, 186, 195
Lsp1109I GCAGC 6 cut(s) 81, 93, 101, 104, 107, 122
MabI ACCWGGT 1 cut(s) 172
MaeIII GTNAC 1 cut(s) 59
MnlI CCTC 6 cut(s) 20, 23, 26, 35, 74, 207
MslI CAYNNNNRTG 1 cut(s) 10
MspA1I CMGCKG 1 cut(s) 72
MspI CCGG 2 cut(s) 23, 38
MspR9I CCNGG 5 cut(s) 24, 39, 165, 174, 183
MvaI CCWGG 3 cut(s) 165, 174, 183
MwoI GCNNNNNNNGC 3 cut(s) 78, 120, 165
NciI CCSGG 2 cut(s) 24, 39
NcoI CCATGG 1 cut(s) 11
NlaIII CATG 1 cut(s) 15
NlaIV GGNNCC 2 cut(s) 18, 193
NmuCI GTSAC 1 cut(s) 59
PfoI TCCNGGA 1 cut(s) 37
PkrI GCNGC 8 cut(s) 71, 83, 116, 119, 122, 137, 158, 161
Psp6I CCWGG 3 cut(s) 163, 172, 181
PspEI GGTNACC 1 cut(s) 59
PspGI CCWGG 3 cut(s) 163, 172, 181
PspN4I GGNNCC 2 cut(s) 18, 193
PspPI GGNCC 7 cut(s) 17, 35, 143, 161, 170, 179, 191
PstI CTGCAG 1 cut(s) 71
RseI CAYNNNNRTG 1 cut(s) 10
SatI GCNGC 8 cut(s) 70, 82, 115, 118, 121, 136, 157, 160
Sau96I GGNCC 7 cut(s) 17, 35, 143, 161, 170, 179, 191
ScrFI CCNGG 5 cut(s) 24, 39, 165, 174, 183
SetI ASST 6 cut(s) 37, 61, 66, 86, 137, 178
SexAI ACCWGGT 1 cut(s) 172
SfcI CTRYAG 1 cut(s) 67
SinI GGWCC 4 cut(s) 17, 35, 143, 170
SmiMI CAYNNNNRTG 1 cut(s) 10
SsiI CCGC 6 cut(s) 20, 72, 156, 159, 168, 186
StyD4I CCNGG 5 cut(s) 22, 37, 163, 172, 181
StyI CCWWGG 1 cut(s) 11
TauI GCSGC 2 cut(s) 159, 162
TscAI CASTG 1 cut(s) 153
TseFI GTSAC 1 cut(s) 59
TseI GCWGC 6 cut(s) 69, 81, 114, 117, 120, 135
Tsp45I GTSAC 1 cut(s) 59
TspRI CASTG 1 cut(s) 153
VpaK11BI GGWCC 4 cut(s) 17, 35, 143, 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.