RchiOBHm_Chr3g0452741

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0022242
Physical Location & Seq
Forward (+)
3306258 .. 3307458
1201 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ41987

Sequence Viewer

Length: 198 bp
ATGCCTGGTTGGGGACCCCCGCCAGGAGGACCTCCGGGACCTCCAGGGCCGTGCGGTTGCTGTTGGTTTTGTTGCGATGGCATAAGCAGGCTCTTATCTTCATGTTGCTATCTGCTGTTTTGCTGTTGCATCTTTGAGAGCTGCTGTGGACCTGTGTTTGGAGGGCCTCCGCCCGGCGGGCCTCCTCCTCCCTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

6.58

Weight (kDa)

4.37

Isoelectric Point (pI)

78.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022242)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g04150
malus_domestica MD00G1051100.v1.1
prunus_persica Prupe.6G336000_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0452741

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 20, 54, 170, 177
AfiI CCNNNNNNNGG 6 cut(s) 11, 23, 26, 158, 173, 176
AjnI CCWGG 3 cut(s) 4, 22, 43
AluBI AGCT 1 cut(s) 141
AluI AGCT 1 cut(s) 141
AoxI GGCC 3 cut(s) 47, 164, 179
ApeKI GCWGC 1 cut(s) 141
AspS9I GGNCC 7 cut(s) 14, 29, 38, 47, 149, 164, 179
AsuC2I CCSGG 2 cut(s) 36, 174
AvaII GGWCC 4 cut(s) 14, 29, 38, 149
BbvI GCAGC 1 cut(s) 128
BccI CCATC 1 cut(s) 71
BceAI ACGGC 1 cut(s) 34
BciT130I CCWGG 3 cut(s) 6, 24, 45
BcnI CCSGG 2 cut(s) 36, 174
BglI GCCNNNNNGGC 1 cut(s) 178
BisI GCNGC 1 cut(s) 142
BlsI GCNGC 1 cut(s) 143
Bme1390I CCNGG 5 cut(s) 6, 24, 36, 45, 174
Bme18I GGWCC 4 cut(s) 14, 29, 38, 149
BmgT120I GGNCC 7 cut(s) 14, 29, 38, 47, 149, 164, 179
BmiI GGNNCC 3 cut(s) 15, 16, 39
BmrFI CCNGG 5 cut(s) 6, 24, 36, 45, 174
BmsI GCATC 1 cut(s) 138
BpmI CTGGAG 1 cut(s) 27
BpuMI CCSGG 2 cut(s) 36, 174
BsaJI CCNNGG 1 cut(s) 44
Bsc4I CCNNNNNNNGG 6 cut(s) 11, 23, 26, 158, 173, 176
BseBI CCWGG 3 cut(s) 6, 24, 45
BseDI CCNNGG 1 cut(s) 44
BseLI CCNNNNNNNGG 6 cut(s) 11, 23, 26, 158, 173, 176
BseRI GAGGAG 2 cut(s) 174, 177
BseXI GCAGC 1 cut(s) 128
BshFI GGCC 3 cut(s) 49, 166, 181
BsiSI CCGG 2 cut(s) 35, 174
BslFI GGGAC 2 cut(s) 27, 51
BslI CCNNNNNNNGG 6 cut(s) 11, 23, 26, 158, 173, 176
BsmFI GGGAC 2 cut(s) 27, 51
BsnI GGCC 3 cut(s) 49, 166, 181
BspACI CCGC 4 cut(s) 20, 54, 170, 177
BspANI GGCC 3 cut(s) 49, 166, 181
BspLI GGNNCC 3 cut(s) 15, 16, 39
BssECI CCNNGG 1 cut(s) 44
Bst2UI CCWGG 3 cut(s) 6, 24, 45
BstC8I GCNNGC 2 cut(s) 89, 179
BstMWI GCNNNNNNNGC 1 cut(s) 178
BstNI CCWGG 3 cut(s) 6, 24, 45
BstSCI CCNGG 5 cut(s) 4, 22, 34, 43, 172
BstV1I GCAGC 1 cut(s) 128
BsuRI GGCC 3 cut(s) 49, 166, 181
BtgZI GCGATG 1 cut(s) 90
Cac8I GCNNGC 2 cut(s) 89, 179
Cfr13I GGNCC 7 cut(s) 14, 29, 38, 47, 149, 164, 179
CviAII CATG 1 cut(s) 102
CviJI RGCY 5 cut(s) 49, 91, 141, 166, 181
CviKI_1 RGCY 5 cut(s) 49, 91, 141, 166, 181
EciI GGCGGA 1 cut(s) 159
Eco47I GGWCC 4 cut(s) 14, 29, 38, 149
EcoO109I RGGNCCY 4 cut(s) 14, 29, 38, 164
EcoRII CCWGG 3 cut(s) 4, 22, 43
FaeI CATG 1 cut(s) 105
FaiI YATR 2 cut(s) 83, 103
FaqI GGGAC 2 cut(s) 27, 51
FatI CATG 1 cut(s) 101
FauI CCCGC 2 cut(s) 27, 170
Fnu4HI GCNGC 1 cut(s) 142
Fsp4HI GCNGC 1 cut(s) 142
GluI GCNGC 1 cut(s) 142
GsuI CTGGAG 1 cut(s) 27
HaeIII GGCC 3 cut(s) 49, 166, 181
HapII CCGG 2 cut(s) 35, 174
Hin1II CATG 1 cut(s) 105
HpaII CCGG 2 cut(s) 35, 174
Hpy166II GTNNAC 1 cut(s) 149
Hpy188I TCNGA 1 cut(s) 197
Hpy8I GTNNAC 1 cut(s) 149
HpyCH4V TGCA 1 cut(s) 129
HpyF10VI GCNNNNNNNGC 1 cut(s) 178
Hsp92II CATG 1 cut(s) 105
KflI GGGWCCC 1 cut(s) 14
LpnPI CCDG 9 cut(s) 9, 18, 30, 36, 48, 57, 73, 165, 187
Lsp1109I GCAGC 1 cut(s) 128
LweI GCATC 1 cut(s) 138
MboII GAAGA 1 cut(s) 90
MnlI CCTC 8 cut(s) 20, 42, 51, 155, 177, 192, 195, 198
MspI CCGG 2 cut(s) 35, 174
MspR9I CCNGG 5 cut(s) 6, 24, 36, 45, 174
MvaI CCWGG 3 cut(s) 6, 24, 45
MwoI GCNNNNNNNGC 1 cut(s) 178
NciI CCSGG 2 cut(s) 36, 174
NlaIII CATG 1 cut(s) 105
NlaIV GGNNCC 3 cut(s) 15, 16, 39
PfoI TCCNGGA 1 cut(s) 34
PkrI GCNGC 1 cut(s) 143
PpuMI RGGWCCY 3 cut(s) 14, 29, 38
Psp5II RGGWCCY 3 cut(s) 14, 29, 38
Psp6I CCWGG 3 cut(s) 4, 22, 43
PspGI CCWGG 3 cut(s) 4, 22, 43
PspN4I GGNNCC 3 cut(s) 15, 16, 39
PspPI GGNCC 7 cut(s) 14, 29, 38, 47, 149, 164, 179
PspPPI RGGWCCY 3 cut(s) 14, 29, 38
SatI GCNGC 1 cut(s) 142
Sau96I GGNCC 7 cut(s) 14, 29, 38, 47, 149, 164, 179
ScrFI CCNGG 5 cut(s) 6, 24, 36, 45, 174
SetI ASST 4 cut(s) 34, 43, 143, 154
SfaNI GCATC 1 cut(s) 138
SinI GGWCC 4 cut(s) 14, 29, 38, 149
SsiI CCGC 4 cut(s) 20, 54, 170, 177
StyD4I CCNGG 5 cut(s) 4, 22, 34, 43, 172
TseI GCWGC 1 cut(s) 141
TspDTI ATGAA 1 cut(s) 90
VpaK11BI GGWCC 4 cut(s) 14, 29, 38, 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.