MD01G1047500.v1.1

Fantastic Four meristem regulator

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
Physical Location & Seq
Forward (+)
14963784 .. 14964839
1056 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1047500.v1.1.491

Sequence Viewer

Length: 162 bp
ATGAATGTGTCTTCGGATGAAGATCATTGCAATAGCCTTTTGAGCTTCGTCAACAGGTTTGTCGGTGATATGTGTCTCGATGGTGGCTCTAATGCCCTTTGCAGTGAGATGGAGCTTCACATCTTGAACCCACTTCAGATAGTTTCTTCCAGAGACTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

5.86

Weight (kDa)

4.23

Isoelectric Point (pI)

46.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022383)

Species Orthologous Gene IDs
malus_domestica MD01G1047500.v1.1 MD07G1049500.v1.1 MD12G1083500.v1.1
pyrus_communis pycom13g23540

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 119
AgsI TTSAA 1 cut(s) 127
AluBI AGCT 2 cut(s) 45, 115
AluI AGCT 2 cut(s) 45, 115
Alw26I GTCTC 2 cut(s) 80, 147
AsuHPI GGTGA 1 cut(s) 77
BbsI GAAGAC 1 cut(s) 3
BccI CCATC 2 cut(s) 74, 103
BcoDI GTCTC 2 cut(s) 80, 147
BfaI CTAG 1 cut(s) 160
BpiI GAAGAC 1 cut(s) 3
BsaBI GATNNNNATC 1 cut(s) 21
Bse3DI GCAATG 1 cut(s) 25
Bse8I GATNNNNATC 1 cut(s) 21
BseGI GGATG 1 cut(s) 22
BseJI GATNNNNATC 1 cut(s) 21
BseMI GCAATG 1 cut(s) 25
BsmAI GTCTC 2 cut(s) 80, 147
Bsp143I GATC 1 cut(s) 22
BsrDI GCAATG 1 cut(s) 25
BssMI GATC 1 cut(s) 22
BstF5I GGATG 1 cut(s) 22
BstKTI GATC 1 cut(s) 25
BstMAI GTCTC 2 cut(s) 80, 147
BstMBI GATC 1 cut(s) 22
BstMWI GCNNNNNNNGC 1 cut(s) 42
BstV2I GAAGAC 1 cut(s) 3
BtsCI GGATG 1 cut(s) 22
BtsI GCAGTG 1 cut(s) 109
BtsIMutI CAGTG 1 cut(s) 109
CviJI RGCY 4 cut(s) 36, 45, 87, 115
CviKI_1 RGCY 4 cut(s) 36, 45, 87, 115
DpnI GATC 1 cut(s) 24
DpnII GATC 1 cut(s) 22
Eco57I CTGAAG 1 cut(s) 119
FaiI YATR 1 cut(s) 71
FokI GGATG 1 cut(s) 29
FspBI CTAG 1 cut(s) 160
HincII GTYRAC 1 cut(s) 52
HindII GTYRAC 1 cut(s) 52
HphI GGTGA 1 cut(s) 77
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 2 cut(s) 16, 138
Hpy188III TCNNGA 3 cut(s) 77, 124, 150
Hpy8I GTNNAC 1 cut(s) 52
HpyCH4V TGCA 2 cut(s) 30, 102
HpyF10VI GCNNNNNNNGC 1 cut(s) 42
Kzo9I GATC 1 cut(s) 22
LmnI GCTCC 1 cut(s) 112
LpnPI CCDG 1 cut(s) 40
MaeI CTAG 1 cut(s) 160
MalI GATC 1 cut(s) 24
MboI GATC 1 cut(s) 22
MboII GAAGA 3 cut(s) 3, 32, 138
MwoI GCNNNNNNNGC 1 cut(s) 42
NdeII GATC 1 cut(s) 22
Sau3AI GATC 1 cut(s) 22
SetI ASST 3 cut(s) 47, 59, 117
SgeI CNNG 3 cut(s) 67, 89, 136
SspMI CTAG 1 cut(s) 160
TaqI TCGA 1 cut(s) 78
TscAI CASTG 1 cut(s) 109
TspDTI ATGAA 2 cut(s) 17, 33
TspRI CASTG 1 cut(s) 109
XspI CTAG 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.