MD02G1249200.v1.1

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Forward (+)
29984541 .. 29984729
189 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1249200.v1.1.491

Sequence Viewer

Length: 189 bp
ATGGGTCATATTCACCACGTCAGTGTGGCTCGCTTGGTTGGTTTTTGTGCTGATGGATTTAGACGAACTCTGGTTTATGCGTTATTTCCCAATGGTTCACTCCAAGATTATATTTCATCTGTAGATAGTAAGGTTTATTTCCTTGGTTGGGATAAGTTGCAAGATATTGCTATTGGCCACGCCAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

6.92

Weight (kDa)

7.96

Isoelectric Point (pI)

45.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024370)

Species Orthologous Gene IDs
malus_domestica MD01G1006900.v1.1 MD02G1249200.v1.1
rosa_chinensis RchiOBHm_Chr3g0482481

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 175
AfiI CCNNNNNNNGG 1 cut(s) 148
AjiI CACGTC 1 cut(s) 19
AleI CACNNNNGTG 1 cut(s) 21
AoxI GGCC 1 cut(s) 175
AsuHPI GGTGA 1 cut(s) 5
BalI TGGCCA 1 cut(s) 177
BccI CCATC 1 cut(s) 47
BfmI CTRYAG 1 cut(s) 120
BmgBI CACGTC 1 cut(s) 19
BsaJI CCNNGG 1 cut(s) 142
Bsc4I CCNNNNNNNGG 1 cut(s) 148
BseDI CCNNGG 1 cut(s) 142
BseLI CCNNNNNNNGG 1 cut(s) 148
BshFI GGCC 1 cut(s) 177
BslI CCNNNNNNNGG 1 cut(s) 148
BsnI GGCC 1 cut(s) 177
BspANI GGCC 1 cut(s) 177
BssECI CCNNGG 1 cut(s) 142
BssT1I CCWWGG 1 cut(s) 142
BstC8I GCNNGC 1 cut(s) 31
BstSFI CTRYAG 1 cut(s) 120
BsuRI GGCC 1 cut(s) 177
BtrI CACGTC 1 cut(s) 19
BtsIMutI CAGTG 1 cut(s) 28
Cac8I GCNNGC 1 cut(s) 31
CviJI RGCY 2 cut(s) 29, 177
CviKI_1 RGCY 2 cut(s) 29, 177
EaeI YGGCCR 1 cut(s) 175
Eco130I CCWWGG 1 cut(s) 142
EcoT14I CCWWGG 1 cut(s) 142
ErhI CCWWGG 1 cut(s) 142
FaiI YATR 3 cut(s) 9, 78, 111
HaeIII GGCC 1 cut(s) 177
HphI GGTGA 1 cut(s) 5
Hpy166II GTNNAC 1 cut(s) 98
Hpy8I GTNNAC 1 cut(s) 98
HpyCH4IV ACGT 1 cut(s) 18
HpyCH4V TGCA 1 cut(s) 160
HpySE526I ACGT 1 cut(s) 18
LpnPI CCDG 1 cut(s) 56
MaeII ACGT 1 cut(s) 18
MlsI TGGCCA 1 cut(s) 177
MluNI TGGCCA 1 cut(s) 177
Mox20I TGGCCA 1 cut(s) 177
MscI TGGCCA 1 cut(s) 177
MslI CAYNNNNRTG 1 cut(s) 21
Msp20I TGGCCA 1 cut(s) 177
OliI CACNNNNGTG 1 cut(s) 21
RseI CAYNNNNRTG 1 cut(s) 21
SetI ASST 2 cut(s) 21, 135
SfcI CTRYAG 1 cut(s) 120
SgeI CNNG 7 cut(s) 29, 42, 46, 83, 116, 155, 173
SmiMI CAYNNNNRTG 1 cut(s) 21
StyI CCWWGG 1 cut(s) 142
TaiI ACGT 1 cut(s) 21
TscAI CASTG 1 cut(s) 28
TspDTI ATGAA 1 cut(s) 105
TspRI CASTG 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.