MD02G1293800.v1.1

Histone chaperone domain CHZ

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
OG0024322
Physical Location & Seq
Forward (+)
34908004 .. 34909076
1073 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1293800.v1.1.491

Sequence Viewer

Length: 141 bp
ATGGTAATGGTGGAGGATGCGCAAGATAGCGAGAGCCCTCTGAAGGAGGCGCACGATATCCAGTCCCAGATTAAGAGTGCTATGCAGTCACGCGTCCCTTGCTTAAAAGAACTATCCGAGTCATATATTTTGCCATCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CHZ

Protein Analysis

47

Amino Acids

5.15

Weight (kDa)

4.55

Isoelectric Point (pI)

86.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024322)

Species Orthologous Gene IDs
malus_domestica MD02G1293800.v1.1 MD09G1164000.v1.1
pyrus_communis pycom15g31410

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 21
AccII CGCG 1 cut(s) 93
AcuI CTGAAG 1 cut(s) 62
AfiI CCNNNNNNNGG 1 cut(s) 43
AflIII ACRYGT 1 cut(s) 91
AspLEI GCGC 2 cut(s) 22, 52
BanII GRGCYC 1 cut(s) 38
BmsI GCATC 1 cut(s) 7
Bsc4I CCNNNNNNNGG 1 cut(s) 43
Bse1I ACTGG 1 cut(s) 61
BseGI GGATG 1 cut(s) 22
BseLI CCNNNNNNNGG 1 cut(s) 43
BseNI ACTGG 1 cut(s) 61
Bsh1236I CGCG 1 cut(s) 93
BslFI GGGAC 2 cut(s) 49, 80
BslI CCNNNNNNNGG 1 cut(s) 43
BsmFI GGGAC 2 cut(s) 49, 80
Bsp1286I GDGCHC 1 cut(s) 38
BspFNI CGCG 1 cut(s) 93
BsrI ACTGG 1 cut(s) 61
BstF5I GGATG 1 cut(s) 22
BstFNI CGCG 1 cut(s) 93
BstHHI GCGC 2 cut(s) 22, 52
BstMWI GCNNNNNNNGC 1 cut(s) 99
BstUI CGCG 1 cut(s) 93
BtsCI GGATG 1 cut(s) 22
CfoI GCGC 2 cut(s) 22, 52
CseI GACGC 1 cut(s) 82
CviJI RGCY 1 cut(s) 36
CviKI_1 RGCY 1 cut(s) 36
Eco24I GRGCYC 1 cut(s) 38
Eco32I GATATC 1 cut(s) 58
Eco57I CTGAAG 1 cut(s) 62
EcoRV GATATC 1 cut(s) 58
EcoT38I GRGCYC 1 cut(s) 38
FaiI YATR 3 cut(s) 83, 124, 126
FaqI GGGAC 2 cut(s) 49, 80
FokI GGATG 1 cut(s) 29
FriOI GRGCYC 1 cut(s) 38
FspI TGCGCA 1 cut(s) 21
GlaI GCGC 2 cut(s) 21, 51
HgaI GACGC 1 cut(s) 82
HhaI GCGC 2 cut(s) 22, 52
Hin6I GCGC 2 cut(s) 20, 50
HinP1I GCGC 2 cut(s) 20, 50
HinfI GANTC 1 cut(s) 119
Hpy188I TCNGA 2 cut(s) 42, 118
HpyAV CCTTC 1 cut(s) 37
HpyCH4V TGCA 1 cut(s) 85
HpyF10VI GCNNNNNNNGC 1 cut(s) 99
HspAI GCGC 2 cut(s) 20, 50
LpnPI CCDG 2 cut(s) 74, 80
LweI GCATC 1 cut(s) 7
MaeIII GTNAC 1 cut(s) 87
MhlI GDGCHC 1 cut(s) 38
MluI ACGCGT 1 cut(s) 91
MlyI GAGTC 1 cut(s) 128
MnlI CCTC 3 cut(s) 7, 40, 48
MseI TTAA 3 cut(s) 72, 104, 139
MvnI CGCG 1 cut(s) 93
MwoI GCNNNNNNNGC 1 cut(s) 99
NmuCI GTSAC 1 cut(s) 87
NsbI TGCGCA 1 cut(s) 21
PleI GAGTC 1 cut(s) 127
PpsI GAGTC 1 cut(s) 127
SaqAI TTAA 3 cut(s) 72, 104, 139
SchI GAGTC 1 cut(s) 128
SduI GDGCHC 1 cut(s) 38
SfaNI GCATC 1 cut(s) 7
SgeI CNNG 9 cut(s) 35, 43, 65, 73, 79, 102, 104, 111, 130
Tru1I TTAA 3 cut(s) 72, 104, 139
Tru9I TTAA 3 cut(s) 72, 104, 139
TseFI GTSAC 1 cut(s) 87
Tsp45I GTSAC 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.