MD05G1149100.v1.1

Chloride channel protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0020396
Physical Location & Seq
Reverse (-)
28027897 .. 28028237
341 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1149100.v1.1.491

Sequence Viewer

Length: 300 bp
ATGGCATTGACATATCCAGAAATTCTTTATCGGGGTTTCGAGAATGTTGACATTTTGCTGGAATCTCGACCACTTGAGAAAGGCCTCTCAGCTGATCAGTTTCTTCAGTTGGTAGTGGTCAAGATAGGTGCAACCTCATTGTGTCGAGCCTCTGGATTAGTTGGAGGCTACTATGCTCCATCACTTTTTACTGGTGCAGCAACAGGAATGGCATACGGAAAATTCATCCGTTCTGCAGTTCTCAGTCCAATCCTATACTTCATCAGTTCTGGCAATGTTGAACTAGTATGCTTGATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0016020
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CBS Voltage_CLC

Protein Analysis

100

Amino Acids

10.64

Weight (kDa)

6.13

Isoelectric Point (pI)

38.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Voltage_CLC PF00654 2 - 82 9.3e-13 Voltage gated chloride channel
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020396)

Species Orthologous Gene IDs
malus_domestica MD05G1146100.v1.1 MD05G1149100.v1.1 MD05G1150500.v1.1
pyrus_communis pycom05g14230 pycom05g14270 pycom05g14400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 21, 221
AcuI CTGAAG 1 cut(s) 89
AgsI TTSAA 1 cut(s) 281
AhlI ACTAGT 1 cut(s) 283
AluBI AGCT 1 cut(s) 92
AluI AGCT 1 cut(s) 92
AoxI GGCC 1 cut(s) 82
ApeKI GCWGC 1 cut(s) 197
ApoI RAATTY 2 cut(s) 21, 221
BbvI GCAGC 1 cut(s) 209
BccI CCATC 1 cut(s) 187
BclI TGATCA 1 cut(s) 94
BcuI ACTAGT 1 cut(s) 283
BfaI CTAG 1 cut(s) 284
BfmI CTRYAG 1 cut(s) 234
BisI GCNGC 1 cut(s) 198
BlsI GCNGC 1 cut(s) 199
BpuEI CTTGAG 1 cut(s) 95
Bse1I ACTGG 1 cut(s) 196
Bse3DI GCAATG 1 cut(s) 280
BseGI GGATG 1 cut(s) 225
BseMI GCAATG 1 cut(s) 280
BseMII CTCAG 2 cut(s) 102, 256
BseNI ACTGG 1 cut(s) 196
BseXI GCAGC 1 cut(s) 209
BsgI GTGCAG 1 cut(s) 216
BshFI GGCC 1 cut(s) 84
BsnI GGCC 1 cut(s) 84
Bsp143I GATC 1 cut(s) 94
BspANI GGCC 1 cut(s) 84
BspCNI CTCAG 2 cut(s) 101, 255
BspMAI CTGCAG 1 cut(s) 238
BsrDI GCAATG 1 cut(s) 280
BsrI ACTGG 1 cut(s) 196
BssMI GATC 1 cut(s) 94
BstDEI CTNAG 2 cut(s) 88, 242
BstF5I GGATG 1 cut(s) 225
BstKTI GATC 1 cut(s) 97
BstMBI GATC 1 cut(s) 94
BstSFI CTRYAG 1 cut(s) 234
BstV1I GCAGC 1 cut(s) 209
BsuRI GGCC 1 cut(s) 84
BtsCI GGATG 1 cut(s) 225
CviJI RGCY 4 cut(s) 84, 92, 149, 168
CviKI_1 RGCY 4 cut(s) 84, 92, 149, 168
DdeI CTNAG 2 cut(s) 88, 242
DpnI GATC 1 cut(s) 96
DpnII GATC 1 cut(s) 94
Eco147I AGGCCT 1 cut(s) 84
Eco57I CTGAAG 1 cut(s) 89
FaiI YATR 6 cut(s) 13, 174, 214, 256, 289, 298
FbaI TGATCA 1 cut(s) 94
Fnu4HI GCNGC 1 cut(s) 198
FokI GGATG 1 cut(s) 212
Fsp4HI GCNGC 1 cut(s) 198
FspBI CTAG 1 cut(s) 284
GluI GCNGC 1 cut(s) 198
HaeIII GGCC 1 cut(s) 84
HincII GTYRAC 1 cut(s) 49
HindII GTYRAC 1 cut(s) 49
HinfI GANTC 1 cut(s) 62
Hpy166II GTNNAC 1 cut(s) 49
Hpy188III TCNNGA 5 cut(s) 17, 40, 66, 121, 153
Hpy8I GTNNAC 1 cut(s) 49
HpyCH4V TGCA 3 cut(s) 131, 197, 236
HpyF3I CTNAG 2 cut(s) 88, 242
Ksp22I TGATCA 1 cut(s) 94
Kzo9I GATC 1 cut(s) 94
LmnI GCTCC 1 cut(s) 181
LpnPI CCDG 6 cut(s) 30, 44, 138, 177, 189, 255
Lsp1109I GCAGC 1 cut(s) 209
MaeI CTAG 1 cut(s) 284
MalI GATC 1 cut(s) 96
MboI GATC 1 cut(s) 94
MboII GAAGA 1 cut(s) 95
MluCI AATT 2 cut(s) 21, 221
MmeI TCCRAC 1 cut(s) 142
MnlI CCTC 4 cut(s) 95, 145, 158, 160
MspA1I CMGCKG 1 cut(s) 92
NdeII GATC 1 cut(s) 94
PceI AGGCCT 1 cut(s) 84
PfeI GAWTC 1 cut(s) 62
PkrI GCNGC 1 cut(s) 199
PstI CTGCAG 1 cut(s) 238
PvuII CAGCTG 1 cut(s) 92
SatI GCNGC 1 cut(s) 198
Sau3AI GATC 1 cut(s) 94
SetI ASST 3 cut(s) 94, 130, 137
SfcI CTRYAG 1 cut(s) 234
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
SpeI ACTAGT 1 cut(s) 283
Sse9I AATT 2 cut(s) 21, 221
SseBI AGGCCT 1 cut(s) 84
SspMI CTAG 1 cut(s) 284
StuI AGGCCT 1 cut(s) 84
TaqI TCGA 3 cut(s) 39, 67, 145
TasI AATT 2 cut(s) 21, 221
TfiI GAWTC 1 cut(s) 62
TseI GCWGC 1 cut(s) 197
TspDTI ATGAA 2 cut(s) 214, 250
TspGWI ACGGA 2 cut(s) 218, 231
XapI RAATTY 2 cut(s) 21, 221
XspI CTAG 1 cut(s) 284
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.