MD06G1057800.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
Physical Location & Seq
Reverse (-)
8931632 .. 8931948
317 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1057800.v1.1.491

Sequence Viewer

Length: 138 bp
ATGATTGGTGGAAGACTATCAACAAAGCATGCACTTTATGGAAGGGAAGCTTGGAGAGAGCCGTGGTTGGCATGGCTAGTGGAAGGAGCACCGCAGAAATTGGTGGCAAAACAATGGAAATTTACAAGACAAGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

46

Amino Acids

5.32

Weight (kDa)

10.16

Isoelectric Point (pI)

38.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022292)

Species Orthologous Gene IDs
malus_domestica MD04G1113800.v1.1 MD06G1057800.v1.1 MD10G1107400.v1.1
pyrus_communis pycom10g03930

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 92
AcsI RAATTY 1 cut(s) 119
AjuI GAANNNNNNNTTGG 2 cut(s) 34, 66
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
Alw21I GWGCWC 1 cut(s) 91
ApoI RAATTY 1 cut(s) 119
BbsI GAAGAC 1 cut(s) 19
Bbv12I GWGCWC 1 cut(s) 91
BceAI ACGGC 1 cut(s) 46
BfaI CTAG 1 cut(s) 77
BpiI GAAGAC 1 cut(s) 19
BsaJI CCNNGG 1 cut(s) 62
BseDI CCNNGG 1 cut(s) 62
BsiHKAI GWGCWC 1 cut(s) 91
Bsp1286I GDGCHC 1 cut(s) 91
BspACI CCGC 1 cut(s) 92
BssECI CCNNGG 1 cut(s) 62
BstC8I GCNNGC 1 cut(s) 30
BstDSI CCRYGG 1 cut(s) 62
BstNSI RCATGY 1 cut(s) 32
BstV2I GAAGAC 1 cut(s) 19
BtgI CCRYGG 1 cut(s) 62
Cac8I GCNNGC 1 cut(s) 30
CviAII CATG 2 cut(s) 29, 72
CviJI RGCY 3 cut(s) 50, 61, 76
CviKI_1 RGCY 3 cut(s) 50, 61, 76
FaeI CATG 2 cut(s) 32, 75
FaiI YATR 3 cut(s) 30, 39, 73
FalI AAGNNNNNCTT 2 cut(s) 34, 66
FatI CATG 2 cut(s) 28, 71
FspBI CTAG 1 cut(s) 77
Hin1II CATG 2 cut(s) 32, 75
HindIII AAGCTT 1 cut(s) 48
HpyAV CCTTC 2 cut(s) 36, 77
HpyCH4V TGCA 1 cut(s) 32
Hsp92II CATG 2 cut(s) 32, 75
LmnI GCTCC 1 cut(s) 86
MaeI CTAG 1 cut(s) 77
MboII GAAGA 1 cut(s) 24
MhlI GDGCHC 1 cut(s) 91
MluCI AATT 2 cut(s) 98, 119
NlaIII CATG 2 cut(s) 32, 75
NspI RCATGY 1 cut(s) 32
PaeI GCATGC 1 cut(s) 32
SduI GDGCHC 1 cut(s) 91
SetI ASST 1 cut(s) 52
SgeI CNNG 5 cut(s) 41, 63, 75, 84, 89
SphI GCATGC 1 cut(s) 32
Sse9I AATT 2 cut(s) 98, 119
SsiI CCGC 1 cut(s) 92
SspMI CTAG 1 cut(s) 77
TasI AATT 2 cut(s) 98, 119
XapI RAATTY 1 cut(s) 119
XceI RCATGY 1 cut(s) 32
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.