MD06G1072100.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0022316
Physical Location & Seq
Forward (+)
17736390 .. 17736990
601 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1072100.v1.1.491

Sequence Viewer

Length: 189 bp
ATGGCGGATAGAAAGAACGATAAGAGTGTGCACGATGGCAACCCGCATGATTTGAGAGAGCATTTTGAGTTTGCTCATGCTATTGCTGTAGCTATGGGGAATAATTACCCCACTGCTAAGTGGCGTTCTTGGAAAGATGTGCCCAGGACTTTGAAGAGGGCTGTGATGGATGAACTATTATGTAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.22

Weight (kDa)

8.93

Isoelectric Point (pI)

18.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022316)

Species Orthologous Gene IDs
malus_domestica MD06G1072100.v1.1 MD09G1237700.v1.1 MD17G1261600.v1.1
pyrus_communis pycom08g10000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 5, 44
AgsI TTSAA 1 cut(s) 154
AjnI CCWGG 1 cut(s) 143
AluBI AGCT 1 cut(s) 92
AluI AGCT 1 cut(s) 92
Alw21I GWGCWC 1 cut(s) 33
Alw44I GTGCAC 1 cut(s) 29
ApaLI GTGCAC 1 cut(s) 29
BaeGI GKGCMC 2 cut(s) 33, 144
Bbv12I GWGCWC 1 cut(s) 33
BccI CCATC 2 cut(s) 29, 160
BciT130I CCWGG 1 cut(s) 145
BfmI CTRYAG 1 cut(s) 87
Bme1390I CCNGG 1 cut(s) 145
BmrFI CCNGG 1 cut(s) 145
BsaJI CCNNGG 1 cut(s) 143
BseBI CCWGG 1 cut(s) 145
BseDI CCNNGG 1 cut(s) 143
BseGI GGATG 1 cut(s) 175
BseSI GKGCMC 2 cut(s) 33, 144
BsiHKAI GWGCWC 1 cut(s) 33
Bsp1286I GDGCHC 2 cut(s) 33, 144
BspACI CCGC 2 cut(s) 5, 44
BssECI CCNNGG 1 cut(s) 143
Bst2UI CCWGG 1 cut(s) 145
Bst6I CTCTTC 1 cut(s) 149
BstDEI CTNAG 1 cut(s) 117
BstF5I GGATG 1 cut(s) 175
BstNI CCWGG 1 cut(s) 145
BstSCI CCNGG 1 cut(s) 143
BstSFI CTRYAG 1 cut(s) 87
BstSLI GKGCMC 2 cut(s) 33, 144
BtsCI GGATG 1 cut(s) 175
BtsI GCAGTG 1 cut(s) 111
BtsIMutI CAGTG 1 cut(s) 111
CviAII CATG 2 cut(s) 47, 77
CviJI RGCY 2 cut(s) 92, 161
CviKI_1 RGCY 2 cut(s) 92, 161
DdeI CTNAG 1 cut(s) 117
Eam1104I CTCTTC 1 cut(s) 149
EarI CTCTTC 1 cut(s) 149
EciI GGCGGA 1 cut(s) 20
EcoRII CCWGG 1 cut(s) 143
FaeI CATG 2 cut(s) 50, 80
FaiI YATR 4 cut(s) 48, 78, 95, 181
FatI CATG 2 cut(s) 46, 76
FauI CCCGC 1 cut(s) 51
FokI GGATG 1 cut(s) 182
Hin1II CATG 2 cut(s) 50, 80
Hpy166II GTNNAC 1 cut(s) 31
Hpy8I GTNNAC 1 cut(s) 31
HpyCH4V TGCA 1 cut(s) 31
HpyF3I CTNAG 1 cut(s) 117
Hsp92II CATG 2 cut(s) 50, 80
LpnPI CCDG 2 cut(s) 130, 157
MboII GAAGA 1 cut(s) 166
MhlI GDGCHC 2 cut(s) 33, 144
MluCI AATT 1 cut(s) 103
MnlI CCTC 1 cut(s) 150
MspR9I CCNGG 1 cut(s) 145
MvaI CCWGG 1 cut(s) 145
NlaIII CATG 2 cut(s) 50, 80
Psp6I CCWGG 1 cut(s) 143
PspGI CCWGG 1 cut(s) 143
ScrFI CCNGG 1 cut(s) 145
SduI GDGCHC 2 cut(s) 33, 144
SetI ASST 1 cut(s) 94
SfcI CTRYAG 1 cut(s) 87
SgeI CNNG 7 cut(s) 44, 55, 59, 89, 141, 156, 157
Sse9I AATT 1 cut(s) 103
SsiI CCGC 2 cut(s) 5, 44
StyD4I CCNGG 1 cut(s) 143
TasI AATT 1 cut(s) 103
TscAI CASTG 1 cut(s) 118
TspDTI ATGAA 1 cut(s) 186
TspRI CASTG 1 cut(s) 118
VneI GTGCAC 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.