MD06G1159900.v1.1

Activating signal cointegrator

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
Physical Location & Seq
Forward (+)
30115892 .. 30120515
4624 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1159900.v1.1.491

Sequence Viewer

Length: 213 bp
ATGTGTAGGGTTCCAGTTTCCAGGTGCTTGAGGTCAATCCCGTTCTGTTTGCAACATACTAGCGATGATTTAAAACATTTTACGGTGGACAATCAATTGGAAACAGCTTCAAATGGGAAGTTTTCGCAAGGGACGCATGTAAGTGGGGTTTGCCCGATGCCGATGGAGAATGCTTTTTGGAATTCCATTAAGGGAAATTTTGGGTTTTATTGA

Protein Analysis

71

Amino Acids

7.88

Weight (kDa)

7.71

Isoelectric Point (pI)

38.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024248)

Species Orthologous Gene IDs
malus_domestica MD06G1159900.v1.1 MD13G1022600.v1.1
pyrus_communis pycom14g05550

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 181, 196
AgsI TTSAA 1 cut(s) 111
AjnI CCWGG 1 cut(s) 20
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
ApoI RAATTY 2 cut(s) 181, 196
BccI CCATC 1 cut(s) 157
BciT130I CCWGG 1 cut(s) 22
BfaI CTAG 1 cut(s) 60
Bme1390I CCNGG 1 cut(s) 22
BmiI GGNNCC 1 cut(s) 12
BmrFI CCNGG 1 cut(s) 22
BmsI GCATC 1 cut(s) 147
BpuEI CTTGAG 1 cut(s) 49
Bse1I ACTGG 1 cut(s) 14
BseBI CCWGG 1 cut(s) 22
BseNI ACTGG 1 cut(s) 14
BslFI GGGAC 1 cut(s) 145
BsmFI GGGAC 1 cut(s) 145
BsmI GAATGC 1 cut(s) 175
BspLI GGNNCC 1 cut(s) 12
BsrI ACTGG 1 cut(s) 14
Bst2UI CCWGG 1 cut(s) 22
Bst4CI ACNGT 1 cut(s) 85
BstMWI GCNNNNNNNGC 1 cut(s) 133
BstNI CCWGG 1 cut(s) 22
BstNSI RCATGY 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 20
BtgZI GCGATG 1 cut(s) 78
CseI GACGC 1 cut(s) 142
CviAII CATG 1 cut(s) 137
CviJI RGCY 1 cut(s) 107
CviKI_1 RGCY 1 cut(s) 107
DraI TTTAAA 1 cut(s) 72
EcoRI GAATTC 1 cut(s) 181
EcoRII CCWGG 1 cut(s) 20
FaeI CATG 1 cut(s) 140
FaiI YATR 2 cut(s) 57, 138
FaqI GGGAC 1 cut(s) 145
FatI CATG 1 cut(s) 136
FspBI CTAG 1 cut(s) 60
HgaI GACGC 1 cut(s) 142
Hin1II CATG 1 cut(s) 140
Hpy166II GTNNAC 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 88
HpyCH4III ACNGT 1 cut(s) 85
HpyCH4V TGCA 1 cut(s) 52
HpyF10VI GCNNNNNNNGC 1 cut(s) 133
Hsp92II CATG 1 cut(s) 140
LpnPI CCDG 3 cut(s) 7, 27, 34
LweI GCATC 1 cut(s) 147
MaeI CTAG 1 cut(s) 60
MfeI CAATTG 1 cut(s) 95
MluCI AATT 3 cut(s) 95, 181, 196
MnlI CCTC 1 cut(s) 24
MseI TTAA 2 cut(s) 71, 189
MslI CAYNNNNRTG 1 cut(s) 141
MspR9I CCNGG 1 cut(s) 22
MunI CAATTG 1 cut(s) 95
Mva1269I GAATGC 1 cut(s) 175
MvaI CCWGG 1 cut(s) 22
MwoI GCNNNNNNNGC 1 cut(s) 133
NlaIII CATG 1 cut(s) 140
NlaIV GGNNCC 1 cut(s) 12
NspI RCATGY 1 cut(s) 140
PctI GAATGC 1 cut(s) 175
Psp6I CCWGG 1 cut(s) 20
PspGI CCWGG 1 cut(s) 20
PspN4I GGNNCC 1 cut(s) 12
RseI CAYNNNNRTG 1 cut(s) 141
SaqAI TTAA 2 cut(s) 71, 189
ScrFI CCNGG 1 cut(s) 22
SetI ASST 3 cut(s) 26, 35, 109
SfaNI GCATC 1 cut(s) 147
SgeI CNNG 9 cut(s) 26, 33, 34, 40, 52, 72, 140, 149, 166
SmiMI CAYNNNNRTG 1 cut(s) 141
SmlI CTYRAG 1 cut(s) 28
SmoI CTYRAG 1 cut(s) 28
Sse9I AATT 3 cut(s) 95, 181, 196
SspMI CTAG 1 cut(s) 60
StyD4I CCNGG 1 cut(s) 20
TaaI ACNGT 1 cut(s) 85
TasI AATT 3 cut(s) 95, 181, 196
Tru1I TTAA 2 cut(s) 71, 189
Tru9I TTAA 2 cut(s) 71, 189
XapI RAATTY 2 cut(s) 181, 196
XceI RCATGY 1 cut(s) 140
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.