MD07G1268300.v1.1

Remorin, C-terminal region

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0024472
Physical Location & Seq
Reverse (-)
33593449 .. 33596240
2792 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1268300.v1.1.491

Sequence Viewer

Length: 438 bp
ATGAATAGAGCTAACAAAAGGCTGGCCATCAATGAGGAGAGAAAGAACGCAGATCAAATAGACCTGGAGGCAGAAGAGAAGAAGATTGAGACAAAAGTTGAGAAGCATAGACACAGGGAACTGGAAAAGCTGAAGAACAAAGAAGCTCACTCCGCGAAGATCATAGAAGACAGTAAGGTCAGAATTGAAGCAAAACGCAATAAAGGACATCTCAATGTTGAAAAGAAGGCTGACAAATTTCGTAACGCCAATACTTTGCCAACCAAGTGCTTTGGCATGTGCTTACCTTACTCCAACCATACAACATATACAATCCCAACTCTCTCTCTCTTTCTCTCTCACCCCCTCCGTCGCTTCTATTGTCTTCTCACTCTAAAGAATACAGTGAACTTCCCTTTGAAAACTTCGAGGTTTCTTCCACCTTCGAACCAACTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Remorin_C

Protein Analysis

146

Amino Acids

16.98

Weight (kDa)

9.86

Isoelectric Point (pI)

46.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Remorin_C PF03763 12 - 89 1.1e-07 Remorin, C-terminal region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024472)

Species Orthologous Gene IDs
malus_domestica MD07G1268300.v1.1
prunus_persica Prupe.2G294000_v2.0.a1
pyrus_communis pycom07g24590

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 176
AccII CGCG 1 cut(s) 155
AciI CCGC 1 cut(s) 153
AcoI YGGCCR 1 cut(s) 24
AcsI RAATTY 1 cut(s) 236
AcuI CTGAAG 1 cut(s) 152
AgsI TTSAA 3 cut(s) 188, 221, 400
AjnI CCWGG 1 cut(s) 63
AluBI AGCT 3 cut(s) 11, 130, 146
AluI AGCT 3 cut(s) 11, 130, 146
Alw26I GTCTC 1 cut(s) 83
AoxI GGCC 1 cut(s) 24
ApoI RAATTY 1 cut(s) 236
AsuHPI GGTGA 1 cut(s) 332
AsuII TTCGAA 1 cut(s) 425
BalI TGGCCA 1 cut(s) 26
BbsI GAAGAC 2 cut(s) 174, 356
BccI CCATC 1 cut(s) 35
BciT130I CCWGG 1 cut(s) 65
BcoDI GTCTC 1 cut(s) 83
Bme1390I CCNGG 1 cut(s) 65
BmrFI CCNGG 1 cut(s) 65
BpiI GAAGAC 2 cut(s) 174, 356
BpmI CTGGAG 1 cut(s) 86
Bpu14I TTCGAA 1 cut(s) 425
Bse1I ACTGG 1 cut(s) 126
BseBI CCWGG 1 cut(s) 65
BseNI ACTGG 1 cut(s) 126
BseRI GAGGAG 1 cut(s) 50
Bsh1236I CGCG 1 cut(s) 155
BshFI GGCC 1 cut(s) 26
BsmAI GTCTC 1 cut(s) 83
BsnI GGCC 1 cut(s) 26
Bsp119I TTCGAA 1 cut(s) 425
Bsp143I GATC 2 cut(s) 52, 159
BspACI CCGC 1 cut(s) 153
BspANI GGCC 1 cut(s) 26
BspFNI CGCG 1 cut(s) 155
BspT104I TTCGAA 1 cut(s) 425
BsrI ACTGG 1 cut(s) 126
BssMI GATC 2 cut(s) 52, 159
Bst2UI CCWGG 1 cut(s) 65
Bst4CI ACNGT 2 cut(s) 173, 385
Bst6I CTCTTC 1 cut(s) 69
BstBI TTCGAA 1 cut(s) 425
BstC8I GCNNGC 1 cut(s) 24
BstFNI CGCG 1 cut(s) 155
BstKTI GATC 2 cut(s) 55, 162
BstMAI GTCTC 1 cut(s) 83
BstMBI GATC 2 cut(s) 52, 159
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstNI CCWGG 1 cut(s) 65
BstNSI RCATGY 1 cut(s) 280
BstSCI CCNGG 1 cut(s) 63
BstUI CGCG 1 cut(s) 155
BstV2I GAAGAC 2 cut(s) 174, 356
BsuRI GGCC 1 cut(s) 26
BtsIMutI CAGTG 1 cut(s) 390
Cac8I GCNNGC 1 cut(s) 24
CviAII CATG 1 cut(s) 277
CviJI RGCY 6 cut(s) 11, 22, 26, 130, 146, 230
CviKI_1 RGCY 6 cut(s) 11, 22, 26, 130, 146, 230
DpnI GATC 2 cut(s) 54, 161
DpnII GATC 2 cut(s) 52, 159
DrdI GACNNNNNNGTC 1 cut(s) 176
DseDI GACNNNNNNGTC 1 cut(s) 176
EaeI YGGCCR 1 cut(s) 24
Eam1104I CTCTTC 1 cut(s) 69
EarI CTCTTC 1 cut(s) 69
Eco57I CTGAAG 1 cut(s) 152
EcoRII CCWGG 1 cut(s) 63
FaeI CATG 1 cut(s) 280
FaiI YATR 6 cut(s) 108, 164, 278, 300, 307, 309
FatI CATG 1 cut(s) 276
GsuI CTGGAG 1 cut(s) 86
HaeIII GGCC 1 cut(s) 26
Hin1II CATG 1 cut(s) 280
HphI GGTGA 1 cut(s) 332
Hpy166II GTNNAC 1 cut(s) 388
Hpy188I TCNGA 1 cut(s) 182
Hpy8I GTNNAC 1 cut(s) 388
Hpy99I CGWCG 1 cut(s) 354
HpyAV CCTTC 2 cut(s) 220, 432
HpyCH4III ACNGT 2 cut(s) 173, 385
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
Hsp92II CATG 1 cut(s) 280
Kzo9I GATC 2 cut(s) 52, 159
LpnPI CCDG 5 cut(s) 8, 50, 77, 100, 107
MaeIII GTNAC 1 cut(s) 242
MalI GATC 2 cut(s) 54, 161
MboI GATC 2 cut(s) 52, 159
MboII GAAGA 8 cut(s) 86, 91, 94, 145, 169, 179, 356, 407
MlsI TGGCCA 1 cut(s) 26
MluCI AATT 2 cut(s) 183, 236
MluNI TGGCCA 1 cut(s) 26
MmeI TCCRAC 1 cut(s) 318
MnlI CCTC 4 cut(s) 28, 61, 356, 402
Mox20I TGGCCA 1 cut(s) 26
MscI TGGCCA 1 cut(s) 26
MslI CAYNNNNRTG 1 cut(s) 213
Msp20I TGGCCA 1 cut(s) 26
MspR9I CCNGG 1 cut(s) 65
MvaI CCWGG 1 cut(s) 65
MvnI CGCG 1 cut(s) 155
MwoI GCNNNNNNNGC 1 cut(s) 152
NdeII GATC 2 cut(s) 52, 159
NlaIII CATG 1 cut(s) 280
NspI RCATGY 1 cut(s) 280
NspV TTCGAA 1 cut(s) 425
Psp6I CCWGG 1 cut(s) 63
PspGI CCWGG 1 cut(s) 63
RseI CAYNNNNRTG 1 cut(s) 213
Sau3AI GATC 2 cut(s) 52, 159
ScrFI CCNGG 1 cut(s) 65
SetI ASST 8 cut(s) 13, 66, 132, 148, 180, 289, 413, 424
SfuI TTCGAA 1 cut(s) 425
SgeI CNNG 9 cut(s) 35, 76, 77, 127, 134, 166, 277, 289, 420
SmiMI CAYNNNNRTG 1 cut(s) 213
Sse9I AATT 2 cut(s) 183, 236
SsiI CCGC 1 cut(s) 153
StyD4I CCNGG 1 cut(s) 63
TaaI ACNGT 2 cut(s) 173, 385
TaqI TCGA 2 cut(s) 407, 425
TasI AATT 2 cut(s) 183, 236
TscAI CASTG 1 cut(s) 390
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 338
TspRI CASTG 1 cut(s) 390
XapI RAATTY 1 cut(s) 236
XceI RCATGY 1 cut(s) 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.