pycom07g24590

Remorin, C-terminal region

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
OG0024472
Physical Location & Seq
Reverse (-)
25240969 .. 25241739
771 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g24590.1

Sequence Viewer

Length: 450 bp
ATGTATAACCGTATCGGTTATAGTGTTTTGGACATATTAATATGTCACACATTTAATTGTTTAAATTTTTCTTCTTCTGCAGAGCTTTTACAAAAGAAGAAGGAAGATACTCTATCCTTCATAAAAACATGGGAGGAGAAACAAAAAACCAAAGTTGATAACAAAGCTAGCAAAAGGCTGGCCATCAATGAGGAGAGAAAGAACGCAGATCAAATAGACCTGGAGGCCGAAGAGAAGAAGATTGAGACAAAAGTTGAGAAGCATAGACACAGGGAACTGGAAAAGCTGAAGAACAAAGAAGCTCACTCCGCGAAGATCATAGAAGACAGTAAGGTCAGAATTGAAGCAAAACGCAACAAAGGACATCTCAGTGTTGAAAAGAAGGCTGACAAATTTCGTAACGCCAATACTTTGCCAACCAAGTGCTTTGGCATGTGCGTGGACGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Remorin_C

Protein Analysis

150

Amino Acids

17.41

Weight (kDa)

9.18

Isoelectric Point (pI)

41.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Remorin_C PF03763 38 - 141 9.1e-13 Remorin, C-terminal region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024472)

Species Orthologous Gene IDs
malus_domestica MD07G1268300.v1.1
prunus_persica Prupe.2G294000_v2.0.a1
pyrus_communis pycom07g24590

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 332
AccII CGCG 1 cut(s) 311
AciI CCGC 1 cut(s) 309
AcoI YGGCCR 1 cut(s) 180
AcsI RAATTY 2 cut(s) 64, 392
AcuI CTGAAG 1 cut(s) 308
AgsI TTSAA 2 cut(s) 344, 377
AjnI CCWGG 1 cut(s) 219
AluBI AGCT 4 cut(s) 85, 167, 286, 302
AluI AGCT 4 cut(s) 85, 167, 286, 302
Alw26I GTCTC 1 cut(s) 239
AoxI GGCC 2 cut(s) 180, 225
ApoI RAATTY 2 cut(s) 64, 392
AseI ATTAAT 1 cut(s) 38
AsuNHI GCTAGC 1 cut(s) 167
BalI TGGCCA 1 cut(s) 182
BbsI GAAGAC 1 cut(s) 330
BccI CCATC 1 cut(s) 191
BciT130I CCWGG 1 cut(s) 221
BcoDI GTCTC 1 cut(s) 239
BfaI CTAG 1 cut(s) 168
BfmI CTRYAG 1 cut(s) 78
Bme1390I CCNGG 1 cut(s) 221
BmrFI CCNGG 1 cut(s) 221
BmtI GCTAGC 1 cut(s) 171
BpiI GAAGAC 1 cut(s) 330
BpmI CTGGAG 1 cut(s) 242
Bse1I ACTGG 1 cut(s) 282
BseBI CCWGG 1 cut(s) 221
BseMII CTCAG 1 cut(s) 382
BseNI ACTGG 1 cut(s) 282
BseRI GAGGAG 2 cut(s) 149, 206
Bsh1236I CGCG 1 cut(s) 311
BshFI GGCC 2 cut(s) 182, 227
BsmAI GTCTC 1 cut(s) 239
BsnI GGCC 2 cut(s) 182, 227
Bsp143I GATC 2 cut(s) 208, 315
BspACI CCGC 1 cut(s) 309
BspANI GGCC 2 cut(s) 182, 227
BspCNI CTCAG 1 cut(s) 381
BspFNI CGCG 1 cut(s) 311
BspMAI CTGCAG 1 cut(s) 82
BspOI GCTAGC 1 cut(s) 171
BsrI ACTGG 1 cut(s) 282
BssMI GATC 2 cut(s) 208, 315
Bst2UI CCWGG 1 cut(s) 221
Bst4CI ACNGT 2 cut(s) 11, 329
Bst6I CTCTTC 1 cut(s) 225
BstC8I GCNNGC 2 cut(s) 169, 180
BstDEI CTNAG 1 cut(s) 368
BstFNI CGCG 1 cut(s) 311
BstKTI GATC 2 cut(s) 211, 318
BstMAI GTCTC 1 cut(s) 239
BstMBI GATC 2 cut(s) 208, 315
BstMWI GCNNNNNNNGC 1 cut(s) 308
BstNI CCWGG 1 cut(s) 221
BstNSI RCATGY 1 cut(s) 436
BstSCI CCNGG 1 cut(s) 219
BstSFI CTRYAG 1 cut(s) 78
BstUI CGCG 1 cut(s) 311
BstV2I GAAGAC 1 cut(s) 330
BsuRI GGCC 2 cut(s) 182, 227
BtsIMutI CAGTG 1 cut(s) 376
Cac8I GCNNGC 2 cut(s) 169, 180
CviAII CATG 2 cut(s) 129, 433
CviJI RGCY 8 cut(s) 85, 167, 178, 182, 227, 286, 302, 386
CviKI_1 RGCY 8 cut(s) 85, 167, 178, 182, 227, 286, 302, 386
DdeI CTNAG 1 cut(s) 368
DpnI GATC 2 cut(s) 210, 317
DpnII GATC 2 cut(s) 208, 315
DraI TTTAAA 1 cut(s) 63
DrdI GACNNNNNNGTC 1 cut(s) 332
DseDI GACNNNNNNGTC 1 cut(s) 332
EaeI YGGCCR 1 cut(s) 180
Eam1104I CTCTTC 1 cut(s) 225
EarI CTCTTC 1 cut(s) 225
Eco57I CTGAAG 1 cut(s) 308
EcoRII CCWGG 1 cut(s) 219
FaeI CATG 2 cut(s) 132, 436
FaiI YATR 9 cut(s) 6, 21, 35, 43, 122, 130, 264, 320, 434
FatI CATG 2 cut(s) 128, 432
FspBI CTAG 1 cut(s) 168
GsuI CTGGAG 1 cut(s) 242
HaeIII GGCC 2 cut(s) 182, 227
Hin1II CATG 2 cut(s) 132, 436
Hpy166II GTNNAC 1 cut(s) 442
Hpy188I TCNGA 1 cut(s) 338
Hpy8I GTNNAC 1 cut(s) 442
HpyAV CCTTC 3 cut(s) 94, 127, 376
HpyCH4III ACNGT 2 cut(s) 11, 329
HpyCH4V TGCA 1 cut(s) 80
HpyF10VI GCNNNNNNNGC 1 cut(s) 308
HpyF3I CTNAG 1 cut(s) 368
Hsp92II CATG 2 cut(s) 132, 436
Kzo9I GATC 2 cut(s) 208, 315
LpnPI CCDG 5 cut(s) 164, 206, 233, 256, 263
MaeI CTAG 1 cut(s) 168
MaeIII GTNAC 2 cut(s) 44, 398
MalI GATC 2 cut(s) 210, 317
MboI GATC 2 cut(s) 208, 315
MlsI TGGCCA 1 cut(s) 182
MluCI AATT 4 cut(s) 55, 64, 339, 392
MluNI TGGCCA 1 cut(s) 182
MnlI CCTC 3 cut(s) 127, 184, 217
Mox20I TGGCCA 1 cut(s) 182
MscI TGGCCA 1 cut(s) 182
MseI TTAA 3 cut(s) 38, 54, 62
MslI CAYNNNNRTG 2 cut(s) 369, 437
Msp20I TGGCCA 1 cut(s) 182
MspR9I CCNGG 1 cut(s) 221
MvaI CCWGG 1 cut(s) 221
MvnI CGCG 1 cut(s) 311
MwoI GCNNNNNNNGC 1 cut(s) 308
NdeII GATC 2 cut(s) 208, 315
NheI GCTAGC 1 cut(s) 167
NlaIII CATG 2 cut(s) 132, 436
NmuCI GTSAC 1 cut(s) 44
NspI RCATGY 1 cut(s) 436
PshBI ATTAAT 1 cut(s) 38
Psp6I CCWGG 1 cut(s) 219
PspGI CCWGG 1 cut(s) 219
PstI CTGCAG 1 cut(s) 82
RseI CAYNNNNRTG 2 cut(s) 369, 437
SaqAI TTAA 3 cut(s) 38, 54, 62
Sau3AI GATC 2 cut(s) 208, 315
ScrFI CCNGG 1 cut(s) 221
SetI ASST 6 cut(s) 87, 169, 222, 288, 304, 336
SfcI CTRYAG 1 cut(s) 78
SmiMI CAYNNNNRTG 2 cut(s) 369, 437
Sse9I AATT 4 cut(s) 55, 64, 339, 392
SsiI CCGC 1 cut(s) 309
SspMI CTAG 1 cut(s) 168
StyD4I CCNGG 1 cut(s) 219
TaaI ACNGT 2 cut(s) 11, 329
TasI AATT 4 cut(s) 55, 64, 339, 392
Tru1I TTAA 3 cut(s) 38, 54, 62
Tru9I TTAA 3 cut(s) 38, 54, 62
TscAI CASTG 1 cut(s) 376
TseFI GTSAC 1 cut(s) 44
Tsp45I GTSAC 1 cut(s) 44
TspDTI ATGAA 1 cut(s) 109
TspRI CASTG 1 cut(s) 376
VspI ATTAAT 1 cut(s) 38
XapI RAATTY 2 cut(s) 64, 392
XceI RCATGY 1 cut(s) 436
XspI CTAG 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.