MD08G1068400.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
OG0024389
Physical Location & Seq
Forward (+)
5445621 .. 5448229
2609 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1068400.v1.1.491

Sequence Viewer

Length: 159 bp
ATGAACTTGCCGACCCTCCGCTCCATCCTCACGTACTTAGCCCCTTCCTTCTCCTCCTCCCGCTTCCTCTCGCCGCTGATCAGAAGCACATTGTCGTCCTCCACCTGGACCTTGATGTCCCCGGACTTCAGTCCCGGCATGTCCACCTCGAACACGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.69

Weight (kDa)

10.74

Isoelectric Point (pI)

95.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024389)

Species Orthologous Gene IDs
malus_domestica MD08G1068400.v1.1
pyrus_communis pycom07g19450
rosa_roxburghii Rroxscaffold_1G00017350

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 115
AccBSI CCGCTC 1 cut(s) 21
AciI CCGC 3 cut(s) 19, 61, 74
AcuI CTGAAG 1 cut(s) 112
AfaI GTAC 1 cut(s) 35
AfiI CCNNNNNNNGG 1 cut(s) 105
AflIII ACRYGT 1 cut(s) 153
AjnI CCWGG 1 cut(s) 104
AspS9I GGNCC 1 cut(s) 108
AsuC2I CCSGG 2 cut(s) 122, 135
AvaII GGWCC 1 cut(s) 108
BccI CCATC 1 cut(s) 32
BciT130I CCWGG 1 cut(s) 106
BclI TGATCA 1 cut(s) 78
BcnI CCSGG 2 cut(s) 122, 135
BisI GCNGC 1 cut(s) 74
BlsI GCNGC 1 cut(s) 75
Bme1390I CCNGG 3 cut(s) 106, 122, 135
Bme18I GGWCC 1 cut(s) 108
BmgT120I GGNCC 1 cut(s) 108
BmrFI CCNGG 3 cut(s) 106, 122, 135
BoxI GACNNNNGTC 1 cut(s) 129
BpuMI CCSGG 2 cut(s) 122, 135
BsaAI YACGTR 2 cut(s) 33, 156
BsaJI CCNNGG 1 cut(s) 120
Bsc4I CCNNNNNNNGG 1 cut(s) 105
BseBI CCWGG 1 cut(s) 106
BseDI CCNNGG 1 cut(s) 120
BseGI GGATG 1 cut(s) 24
BseLI CCNNNNNNNGG 1 cut(s) 105
BseRI GAGGAG 2 cut(s) 43, 46
BsiSI CCGG 2 cut(s) 122, 135
BslFI GGGAC 2 cut(s) 103, 117
BslI CCNNNNNNNGG 1 cut(s) 105
BsmFI GGGAC 2 cut(s) 103, 117
Bsp143I GATC 1 cut(s) 78
BspACI CCGC 3 cut(s) 19, 61, 74
BsrBI CCGCTC 1 cut(s) 21
BssECI CCNNGG 1 cut(s) 120
BssMI GATC 1 cut(s) 78
Bst2UI CCWGG 1 cut(s) 106
BstBAI YACGTR 2 cut(s) 33, 156
BstDEI CTNAG 1 cut(s) 37
BstF5I GGATG 1 cut(s) 24
BstKTI GATC 1 cut(s) 81
BstMBI GATC 1 cut(s) 78
BstNI CCWGG 1 cut(s) 106
BstNSI RCATGY 1 cut(s) 142
BstPAI GACNNNNGTC 1 cut(s) 129
BstSCI CCNGG 3 cut(s) 104, 120, 133
BtsCI GGATG 1 cut(s) 24
Cfr13I GGNCC 1 cut(s) 108
Csp6I GTAC 1 cut(s) 34
CviAII CATG 1 cut(s) 139
CviJI RGCY 1 cut(s) 41
CviKI_1 RGCY 1 cut(s) 41
CviQI GTAC 1 cut(s) 34
DdeI CTNAG 1 cut(s) 37
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
DrdI GACNNNNNNGTC 1 cut(s) 115
DseDI GACNNNNNNGTC 1 cut(s) 115
Eco47I GGWCC 1 cut(s) 108
Eco57I CTGAAG 1 cut(s) 112
EcoRII CCWGG 1 cut(s) 104
FaeI CATG 1 cut(s) 142
FaiI YATR 1 cut(s) 140
FaqI GGGAC 2 cut(s) 103, 117
FatI CATG 1 cut(s) 138
FauI CCCGC 1 cut(s) 68
FbaI TGATCA 1 cut(s) 78
Fnu4HI GCNGC 1 cut(s) 74
FokI GGATG 1 cut(s) 11
Fsp4HI GCNGC 1 cut(s) 74
GluI GCNGC 1 cut(s) 74
HapII CCGG 2 cut(s) 122, 135
Hin1II CATG 1 cut(s) 142
HpaII CCGG 2 cut(s) 122, 135
Hpy166II GTNNAC 1 cut(s) 144
Hpy188I TCNGA 1 cut(s) 83
Hpy8I GTNNAC 1 cut(s) 144
HpyAV CCTTC 2 cut(s) 54, 58
HpyCH4IV ACGT 2 cut(s) 32, 155
HpyF3I CTNAG 1 cut(s) 37
HpySE526I ACGT 2 cut(s) 32, 155
Hsp92II CATG 1 cut(s) 142
Ksp22I TGATCA 1 cut(s) 78
Kzo9I GATC 1 cut(s) 78
LmnI GCTCC 1 cut(s) 26
LpnPI CCDG 4 cut(s) 91, 118, 135, 148
MaeII ACGT 2 cut(s) 32, 155
MalI GATC 1 cut(s) 80
MbiI CCGCTC 1 cut(s) 21
MboI GATC 1 cut(s) 78
MnlI CCTC 7 cut(s) 26, 38, 64, 67, 77, 109, 157
MspA1I CMGCKG 1 cut(s) 76
MspI CCGG 2 cut(s) 122, 135
MspR9I CCNGG 3 cut(s) 106, 122, 135
MvaI CCWGG 1 cut(s) 106
NciI CCSGG 2 cut(s) 122, 135
NdeII GATC 1 cut(s) 78
NlaIII CATG 1 cut(s) 142
NspI RCATGY 1 cut(s) 142
PkrI GCNGC 1 cut(s) 75
Ppu21I YACGTR 2 cut(s) 33, 156
PshAI GACNNNNGTC 1 cut(s) 129
Psp6I CCWGG 1 cut(s) 104
PspGI CCWGG 1 cut(s) 104
PspPI GGNCC 1 cut(s) 108
RsaI GTAC 1 cut(s) 35
RsaNI GTAC 1 cut(s) 34
SatI GCNGC 1 cut(s) 74
Sau3AI GATC 1 cut(s) 78
Sau96I GGNCC 1 cut(s) 108
ScrFI CCNGG 3 cut(s) 106, 122, 135
SetI ASST 5 cut(s) 35, 107, 113, 149, 158
SinI GGWCC 1 cut(s) 108
SsiI CCGC 3 cut(s) 19, 61, 74
StyD4I CCNGG 3 cut(s) 104, 120, 133
TaiI ACGT 2 cut(s) 35, 158
TaqI TCGA 1 cut(s) 149
TauI GCSGC 1 cut(s) 76
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 108
XceI RCATGY 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.